EMAIL THIS PAGE TO A FRIEND

PGLYRP1

peptidoglycan recognition protein 1

42 Gene Product Result for
Synonyms: PGLYRP PGRP PGRP-S PGRPS TAG7 TNFSF3L
UniProtKB ID: O75594, Q4VB36
Gene ID:
Mouse(21946) peptidoglycan recognition protein 1
Rat(84387) peptidoglycan recognition protein 1
dog(612209) peptidoglycan recognition protein 1
domestic cat(101080417) peptidoglycan recognition protein 1
cow(282305) peptidoglycan recognition protein 1
sheep(101115395) peptidoglycan recognition protein 1
domestic guinea pig(100715206) peptidoglycan recognition protein 1
naked mole-rat(101700638) peptidoglycan recognition protein 1
Gene Class: Amidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0724 Human PGLYRP1 / Peptidoglycan Recognition Protein 1 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005091 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005091 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005091 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049471 MISSION® esiRNA targeting human PGLYRP1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005091 Rosetta Predictions human pricing
NM_053373 Rosetta Predictions rat pricing
NM_009402 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113627 predicted 310
2 SASI_Hs01_00113628 predicted 202
3 SASI_Hs01_00113629 predicted 193
4 SASI_Hs01_00113632 predicted 340
5 SASI_Hs01_00113633 predicted 382
6 SASI_Hs02_00338958 predicted 320
7 SASI_Hs02_00338959 predicted 282
8 SASI_Hs01_00113634 predicted 418
9 SASI_Hs01_00113635 predicted 306
10 SASI_Hs02_00338960 predicted 365
11 SASI_Hs01_00113630 predicted 385
12 SASI_Hs01_00113631 predicted 391
13 SASI_Hs01_00113636 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053373 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039162 predicted 241
2 SASI_Rn01_00039163 predicted 206
3 SASI_Rn01_00039164 predicted 304
4 SASI_Rn01_00039165 predicted 248
5 SASI_Rn01_00039166 predicted 361
6 SASI_Rn01_00039167 predicted 300
7 SASI_Rn01_00039168 predicted 282
8 SASI_Rn01_00039169 predicted 276
9 SASI_Rn01_00039170 predicted 242
10 SASI_Rn01_00039171 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062895 predicted 312
2 SASI_Mm01_00062897 predicted 259
3 SASI_Mm01_00062898 predicted 345
4 SASI_Mm01_00062899 predicted 292
5 SASI_Mm01_00062900 predicted 325
6 SASI_Mm01_00062901 predicted 218
7 SASI_Mm01_00062902 predicted 262
8 SASI_Mm01_00062903 predicted 227
9 SASI_Mm01_00062904 predicted 267
10 SASI_Mm02_00316034 predicted 234
11 SASI_Mm01_00062896 predicted 359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009402
VALIDATED
PGLYRP1 MISSION shRNA Bacterial Glycerol Stock
peptidoglycan recognition protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009402.1-435s1c1
Sequence:CCGGGCTGCCCTAAATCTTCTGGAACTCGAGTTCCAGAAGATTTAGGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009402.1-355s1c1
Sequence:CCGGCCATCTGGAATCCCATGTCTACTCGAGTAGACATGGGATTCCAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009402.1-480s1c1
Sequence:CCGGAGATCCAACTATGAAGTCAAACTCGAGTTTGACTTCATAGTTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009402.1-236s1c1
Sequence:CCGGGCAGCATTACCACAAGAATGACTCGAGTCATTCTTGTGGTAATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009402.1-266s1c1
Sequence:CCGGGTGCGATGTAGCCTACAACTTCTCGAGAAGTTGTAGGCTACATCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009402.2-481s21c1
Sequence:CCGGAGATCCAACTATGAAGTCAAACTCGAGTTTGACTTCATAGTTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009402.2-237s21c1
Sequence:CCGGGCAGCATTACCACAAGAATGACTCGAGTCATTCTTGTGGTAATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009402.2-356s21c1
Sequence:CCGGCCATCTGGAATCCCATGTCTACTCGAGTAGACATGGGATTCCAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009402.2-436s21c1
Sequence:CCGGGCTGCCCTAAATCTTCTGGAACTCGAGTTCCAGAAGATTTAGGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009402.2-267s21c1
Sequence:CCGGGTGCGATGTAGCCTACAACTTCTCGAGAAGTTGTAGGCTACATCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009402
VALIDATED
PGLYRP1 MISSION shRNA shRNA Plasmid DNA
peptidoglycan recognition protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009402.1-435s1c1
Sequence:CCGGGCTGCCCTAAATCTTCTGGAACTCGAGTTCCAGAAGATTTAGGGCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000065599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009402.1-355s1c1
Sequence:CCGGCCATCTGGAATCCCATGTCTACTCGAGTAGACATGGGATTCCAGATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000065601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009402.1-480s1c1
Sequence:CCGGAGATCCAACTATGAAGTCAAACTCGAGTTTGACTTCATAGTTGGATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000065602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009402.1-236s1c1
Sequence:CCGGGCAGCATTACCACAAGAATGACTCGAGTCATTCTTGTGGTAATGCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000065600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009402.1-266s1c1
Sequence:CCGGGTGCGATGTAGCCTACAACTTCTCGAGAAGTTGTAGGCTACATCGCACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000326707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009402.2-481s21c1
Sequence:CCGGAGATCCAACTATGAAGTCAAACTCGAGTTTGACTTCATAGTTGGATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000326706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009402.2-237s21c1
Sequence:CCGGGCAGCATTACCACAAGAATGACTCGAGTCATTCTTGTGGTAATGCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000326710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009402.2-356s21c1
Sequence:CCGGCCATCTGGAATCCCATGTCTACTCGAGTAGACATGGGATTCCAGATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000326633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009402.2-436s21c1
Sequence:CCGGGCTGCCCTAAATCTTCTGGAACTCGAGTTCCAGAAGATTTAGGGCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000326708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009402.2-267s21c1
Sequence:CCGGGTGCGATGTAGCCTACAACTTCTCGAGAAGTTGTAGGCTACATCGCACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009402
VALIDATED
PGLYRP1 MISSION shRNA Lentiviral Transduction Particles
peptidoglycan recognition protein 1
Mouse
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000065598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009402.1-435s1c1
Sequence:CCGGGCTGCCCTAAATCTTCTGGAACTCGAGTTCCAGAAGATTTAGGGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009402.1-355s1c1
Sequence:CCGGCCATCTGGAATCCCATGTCTACTCGAGTAGACATGGGATTCCAGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009402.1-480s1c1
Sequence:CCGGAGATCCAACTATGAAGTCAAACTCGAGTTTGACTTCATAGTTGGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009402.1-236s1c1
Sequence:CCGGGCAGCATTACCACAAGAATGACTCGAGTCATTCTTGTGGTAATGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009402.1-266s1c1
Sequence:CCGGGTGCGATGTAGCCTACAACTTCTCGAGAAGTTGTAGGCTACATCGCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009402.2-481s21c1
Sequence:CCGGAGATCCAACTATGAAGTCAAACTCGAGTTTGACTTCATAGTTGGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009402.2-237s21c1
Sequence:CCGGGCAGCATTACCACAAGAATGACTCGAGTCATTCTTGTGGTAATGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009402.2-356s21c1
Sequence:CCGGCCATCTGGAATCCCATGTCTACTCGAGTAGACATGGGATTCCAGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009402.2-436s21c1
Sequence:CCGGGCTGCCCTAAATCTTCTGGAACTCGAGTTCCAGAAGATTTAGGGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009402.2-267s21c1
Sequence:CCGGGTGCGATGTAGCCTACAACTTCTCGAGAAGTTGTAGGCTACATCGCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005091
PGLYRP1 MISSION shRNA Bacterial Glycerol Stock
peptidoglycan recognition protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005091.1-428s1c1
Sequence:CCGGCATCAGCTTCATGGGCAACTACTCGAGTAGTTGCCCATGAAGCTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005091.1-533s1c1
Sequence:CCGGCAACTATGTGCTCAAAGGACACTCGAGTGTCCTTTGAGCACATAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005091.1-321s1c1
Sequence:CCGGGTGGGCTACAACTTCCTGATTCTCGAGAATCAGGAAGTTGTAGCCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005091.1-388s21c1
Sequence:CCGGGTGCCCACTCAGGTCACTTATCTCGAGATAAGTGACCTGAGTGGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005091.1-203s21c1
Sequence:CCGGCTTACGCTATGTGGTGGTATCCTCGAGGATACCACCACATAGCGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005091.1-283s21c1
Sequence:CCGGTGCAGCACTACCACATGAAGACTCGAGTCTTCATGTGGTAGTGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005091.1-419s1c1
Sequence:CCGGGTCCATTGGCATCAGCTTCATCTCGAGATGAAGCTGATGCCAATGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005091.1-532s1c1
Sequence:CCGGCCAACTATGTGCTCAAAGGACCTCGAGGTCCTTTGAGCACATAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005091
PGLYRP1 MISSION shRNA shRNA Plasmid DNA
peptidoglycan recognition protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005091.1-428s1c1
Sequence:CCGGCATCAGCTTCATGGGCAACTACTCGAGTAGTTGCCCATGAAGCTGATGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000178728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005091.1-533s1c1
Sequence:CCGGCAACTATGTGCTCAAAGGACACTCGAGTGTCCTTTGAGCACATAGTTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000154440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005091.1-321s1c1
Sequence:CCGGGTGGGCTACAACTTCCTGATTCTCGAGAATCAGGAAGTTGTAGCCCACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000378876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005091.1-388s21c1
Sequence:CCGGGTGCCCACTCAGGTCACTTATCTCGAGATAAGTGACCTGAGTGGGCACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000378875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005091.1-203s21c1
Sequence:CCGGCTTACGCTATGTGGTGGTATCCTCGAGGATACCACCACATAGCGTAAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000373197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005091.1-283s21c1
Sequence:CCGGTGCAGCACTACCACATGAAGACTCGAGTCTTCATGTGGTAGTGCTGCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000154703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005091.1-419s1c1
Sequence:CCGGGTCCATTGGCATCAGCTTCATCTCGAGATGAAGCTGATGCCAATGGACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000155426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005091.1-532s1c1
Sequence:CCGGCCAACTATGTGCTCAAAGGACCTCGAGGTCCTTTGAGCACATAGTTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005091
PGLYRP1 MISSION shRNA Lentiviral Transduction Particles
peptidoglycan recognition protein 1
Human
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000154365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005091.1-428s1c1
Sequence:CCGGCATCAGCTTCATGGGCAACTACTCGAGTAGTTGCCCATGAAGCTGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005091.1-533s1c1
Sequence:CCGGCAACTATGTGCTCAAAGGACACTCGAGTGTCCTTTGAGCACATAGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005091.1-321s1c1
Sequence:CCGGGTGGGCTACAACTTCCTGATTCTCGAGAATCAGGAAGTTGTAGCCCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005091.1-388s21c1
Sequence:CCGGGTGCCCACTCAGGTCACTTATCTCGAGATAAGTGACCTGAGTGGGCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005091.1-203s21c1
Sequence:CCGGCTTACGCTATGTGGTGGTATCCTCGAGGATACCACCACATAGCGTAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005091.1-283s21c1
Sequence:CCGGTGCAGCACTACCACATGAAGACTCGAGTCTTCATGTGGTAGTGCTGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005091.1-419s1c1
Sequence:CCGGGTCCATTGGCATCAGCTTCATCTCGAGATGAAGCTGATGCCAATGGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005091.1-532s1c1
Sequence:CCGGCCAACTATGTGCTCAAAGGACCTCGAGGTCCTTTGAGCACATAGTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)