EMAIL THIS PAGE TO A FRIEND

PGLYRP2

peptidoglycan recognition protein 2

70 Gene Product Result for
Synonyms: HMFT0141 PGLYRPL PGRP-L PGRPL TAGL-like tagL tagL-alpha tagl-beta
UniProtKB ID: Q96PD5, A8K8C7, B2RMZ2, Q68CK1, Q96N74, Q9UC60
Gene ID:
Human(114770) Summary: This gene encodes a peptidoglycan recognition protein, which belongs to the N-acetylmuramoyl-L-alanine amidase 2 family. This protein hydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in bacterial cell wall glycopeptides, and thus may play a scavenger role by digesting biologically active peptidoglycan into biologically inactive fragments. [provided by RefSeq, Sep 2011]
Mouse(57757) peptidoglycan recognition protein 2
Rat(299567) peptidoglycan recognition protein 2
naked mole-rat(101725687) peptidoglycan recognition protein 2
Domestic Rabbit(100351963) peptidoglycan recognition protein 2
domestic guinea pig(100732886) peptidoglycan recognition protein 2
cow(510803) peptidoglycan recognition protein 2
sheep(101119301) peptidoglycan recognition protein 2
Zebrafish(568634) peptidoglycan recognition protein 2
domestic cat(101089749) peptidoglycan recognition protein 2
dog(610405) peptidoglycan recognition protein 2
chicken(693263) peptidoglycan recognition protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052890 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052890 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052890 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021319 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021319 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021319 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052890 Rosetta Predictions human pricing
NM_021319 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361603 predicted 1222
2 SASI_Hs02_00361604 predicted 1571
3 SASI_Hs02_00361605 predicted 1169
4 SASI_Hs02_00361606 predicted 520
5 SASI_Hs02_00361607 predicted 409
6 SASI_Hs02_00361608 predicted 1018
7 SASI_Hs02_00361609 predicted 674
8 SASI_Hs02_00361610 predicted 422
9 SASI_Hs02_00361611 predicted 341
10 SASI_Hs02_00361612 predicted 714
11 SASI_Hs01_00200557 predicted 1460
12 SASI_Hs01_00200558 predicted 1177
13 SASI_Hs01_00200559 predicted 1908
14 SASI_Hs01_00200560 predicted 2281
15 SASI_Hs01_00200561 predicted 2269
16 SASI_Hs01_00200562 predicted 2033
17 SASI_Hs01_00200563 predicted 2231
18 SASI_Hs01_00200564 predicted 929
19 SASI_Hs01_00200565 predicted 674
20 SASI_Hs01_00200566 predicted 1947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325873 predicted 1578
2 SASI_Mm01_00133722 predicted 265
3 SASI_Mm01_00133723 predicted 1088
4 SASI_Mm01_00133725 predicted 527
5 SASI_Mm01_00133726 predicted 385
6 SASI_Mm01_00133727 predicted 420
7 SASI_Mm01_00133728 predicted 870
8 SASI_Mm01_00133729 predicted 650
9 SASI_Mm01_00133730 predicted 1261
10 SASI_Mm02_00325874 predicted 648
11 SASI_Mm01_00133721 predicted 1103
12 SASI_Mm01_00133724 predicted 587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052890
PGLYRP2 MISSION shRNA Bacterial Glycerol Stock
peptidoglycan recognition protein 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052890.3-292s21c1
Sequence:CCGGGCTGATGTCAGCTCCAAACTCCTCGAGGAGTTTGGAGCTGACATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052890.3-588s21c1
Sequence:CCGGGAGATACCTTTCCAGATGTTGCTCGAGCAACATCTGGAAAGGTATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052890.2-690s1c1
Sequence:CCGGCCAACACTCCAGATGCTACAACTCGAGTTGTAGCATCTGGAGTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052890.2-1901s1c1
Sequence:CCGGCACGTCTATTCAGGAAACCTACTCGAGTAGGTTTCCTGAATAGACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052890.2-1340s1c1
Sequence:CCGGCTGGGATTCTTGTACGTGCATCTCGAGATGCACGTACAAGAATCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052890.2-1224s1c1
Sequence:CCGGCTGCCAATGCTACCAAGGAATCTCGAGATTCCTTGGTAGCATTGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052890.2-352s1c1
Sequence:CCGGGAGCCTCAATGCTACAGAGTTCTCGAGAACTCTGTAGCATTGAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052890
PGLYRP2 MISSION shRNA shRNA Plasmid DNA
peptidoglycan recognition protein 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052890.3-292s21c1
Sequence:CCGGGCTGATGTCAGCTCCAAACTCCTCGAGGAGTTTGGAGCTGACATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052890.3-588s21c1
Sequence:CCGGGAGATACCTTTCCAGATGTTGCTCGAGCAACATCTGGAAAGGTATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052890.2-690s1c1
Sequence:CCGGCCAACACTCCAGATGCTACAACTCGAGTTGTAGCATCTGGAGTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052890.2-1901s1c1
Sequence:CCGGCACGTCTATTCAGGAAACCTACTCGAGTAGGTTTCCTGAATAGACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052890.2-1340s1c1
Sequence:CCGGCTGGGATTCTTGTACGTGCATCTCGAGATGCACGTACAAGAATCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052890.2-1224s1c1
Sequence:CCGGCTGCCAATGCTACCAAGGAATCTCGAGATTCCTTGGTAGCATTGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052890.2-352s1c1
Sequence:CCGGGAGCCTCAATGCTACAGAGTTCTCGAGAACTCTGTAGCATTGAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052890
PGLYRP2 MISSION shRNA Lentiviral Transduction Particles
peptidoglycan recognition protein 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052890.3-292s21c1
Sequence:CCGGGCTGATGTCAGCTCCAAACTCCTCGAGGAGTTTGGAGCTGACATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052890.3-588s21c1
Sequence:CCGGGAGATACCTTTCCAGATGTTGCTCGAGCAACATCTGGAAAGGTATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052890.2-690s1c1
Sequence:CCGGCCAACACTCCAGATGCTACAACTCGAGTTGTAGCATCTGGAGTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052890.2-1901s1c1
Sequence:CCGGCACGTCTATTCAGGAAACCTACTCGAGTAGGTTTCCTGAATAGACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052890.2-1340s1c1
Sequence:CCGGCTGGGATTCTTGTACGTGCATCTCGAGATGCACGTACAAGAATCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052890.2-1224s1c1
Sequence:CCGGCTGCCAATGCTACCAAGGAATCTCGAGATTCCTTGGTAGCATTGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052890.2-352s1c1
Sequence:CCGGGAGCCTCAATGCTACAGAGTTCTCGAGAACTCTGTAGCATTGAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021319
PGLYRP2 MISSION shRNA Bacterial Glycerol Stock
peptidoglycan recognition protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021319.2-324s1c1
Sequence:CCGGCCCTTGCTGAACTTGAGCAAACTCGAGTTTGCTCAAGTTCAGCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021319.2-1175s1c1
Sequence:CCGGGCCCTTGTCCTGTTACAGAAACTCGAGTTTCTGTAACAGGACAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021319.2-1363s1c1
Sequence:CCGGGCTGCCACTTGGATTCTTATACTCGAGTATAAGAATCCAAGTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021319.2-492s1c1
Sequence:CCGGCGGAGCTTCAAGCACTGATTTCTCGAGAAATCAGTGCTTGAAGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021319.2-764s1c1
Sequence:CCGGGCCACTTTACCAAACGACAAACTCGAGTTTGTCGTTTGGTAAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021319
PGLYRP2 MISSION shRNA shRNA Plasmid DNA
peptidoglycan recognition protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021319.2-324s1c1
Sequence:CCGGCCCTTGCTGAACTTGAGCAAACTCGAGTTTGCTCAAGTTCAGCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021319.2-1175s1c1
Sequence:CCGGGCCCTTGTCCTGTTACAGAAACTCGAGTTTCTGTAACAGGACAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021319.2-1363s1c1
Sequence:CCGGGCTGCCACTTGGATTCTTATACTCGAGTATAAGAATCCAAGTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021319.2-492s1c1
Sequence:CCGGCGGAGCTTCAAGCACTGATTTCTCGAGAAATCAGTGCTTGAAGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021319.2-764s1c1
Sequence:CCGGGCCACTTTACCAAACGACAAACTCGAGTTTGTCGTTTGGTAAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021319
PGLYRP2 MISSION shRNA Lentiviral Transduction Particles
peptidoglycan recognition protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021319.2-324s1c1
Sequence:CCGGCCCTTGCTGAACTTGAGCAAACTCGAGTTTGCTCAAGTTCAGCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021319.2-1175s1c1
Sequence:CCGGGCCCTTGTCCTGTTACAGAAACTCGAGTTTCTGTAACAGGACAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021319.2-1363s1c1
Sequence:CCGGGCTGCCACTTGGATTCTTATACTCGAGTATAAGAATCCAAGTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021319.2-492s1c1
Sequence:CCGGCGGAGCTTCAAGCACTGATTTCTCGAGAAATCAGTGCTTGAAGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021319.2-764s1c1
Sequence:CCGGGCCACTTTACCAAACGACAAACTCGAGTTTGTCGTTTGGTAAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)