EMAIL THIS PAGE TO A FRIEND

PGLYRP3

peptidoglycan recognition protein 3

60 Gene Product Result for
Synonyms: PGRP-Ialpha PGRPIA
UniProtKB ID: Q96LB9, A1A4U8, Q5SY65
Gene ID:
Human(114771) Summary: This gene encodes a peptidoglycan recognition protein, which belongs to the N-acetylmuramoyl-L-alanine amidase 2 family. These proteins are part of the innate immune system and recognize peptidoglycan, a ubiquitous component of bacterial cell walls. This protein binds to murein peptidoglycans of Gram-positive bacteria. [provided by RefSeq, Sep 2011]
Mouse(242100) peptidoglycan recognition protein 3
Rat(499658) peptidoglycan recognition protein 3
domestic cat(101089129) peptidoglycan recognition protein 3
cow(532575) peptidoglycan recognition protein 3
sheep(101121908) peptidoglycan recognition protein 3
domestic guinea pig(100734679) peptidoglycan recognition protein 3
naked mole-rat(101729425) peptidoglycan recognition protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA030369 Anti-PGLYRP3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052891 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207247 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207247 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207247 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052891 Rosetta Predictions human pricing
XM_001057607 Rosetta Predictions rat pricing
XM_574982 Rosetta Predictions rat pricing
NM_207247 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087908 predicted 590
2 SASI_Hs01_00087909 predicted 714
3 SASI_Hs01_00087910 predicted 502
4 SASI_Hs01_00087911 predicted 873
5 SASI_Hs01_00087912 predicted 835
6 SASI_Hs01_00087913 predicted 400
7 SASI_Hs01_00087914 predicted 359
8 SASI_Hs01_00087915 predicted 710
9 SASI_Hs01_00087916 predicted 642
10 SASI_Hs01_00087917 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286948 predicted 601
2 SASI_Rn02_00286949 predicted 739
3 SASI_Rn02_00286950 predicted 474
4 SASI_Rn02_00286951 predicted 515
5 SASI_Rn02_00286952 predicted 295
6 SASI_Rn02_00286953 predicted 269
7 SASI_Rn02_00286954 predicted 849
8 SASI_Rn02_00286955 predicted 609
9 SASI_Rn02_00286956 predicted 733
10 SASI_Rn02_00286957 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139753 predicted 602
2 SASI_Rn02_00402866 predicted 736
3 SASI_Rn01_00139754 predicted 477
4 SASI_Rn01_00139755 predicted 513
5 SASI_Rn01_00139756 predicted 293
6 SASI_Rn01_00139757 predicted 262
7 SASI_Rn01_00139758 predicted 842
8 SASI_Rn01_00139759 predicted 611
9 SASI_Rn01_00139762 predicted 740
10 SASI_Rn02_00402867 predicted 228
11 SASI_Rn01_00139760 predicted 683
12 SASI_Rn01_00139761 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207247 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064491 predicted 688
2 SASI_Mm01_00064492 predicted 522
3 SASI_Mm01_00064493 predicted 609
4 SASI_Mm01_00064494 predicted 298
5 SASI_Mm01_00064495 predicted 597
6 SASI_Mm01_00064496 predicted 734
7 SASI_Mm01_00064497 predicted 851
8 SASI_Mm01_00064498 predicted 835
9 SASI_Mm01_00064500 predicted 743
10 SASI_Mm02_00351989 predicted 627
11 SASI_Mm01_00064499 predicted 617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052891
PGLYRP3 MISSION shRNA Bacterial Glycerol Stock
peptidoglycan recognition protein 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052891.1-723s1c1
Sequence:CCGGGTCCGAAACATACAGTCCTTTCTCGAGAAAGGACTGTATGTTTCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052891.1-403s1c1
Sequence:CCGGGCATCGCCTTCTTTGGCAATACTCGAGTATTGCCAAAGAAGGCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052891.1-845s1c1
Sequence:CCGGCACTTATGGATTCAACGATATCTCGAGATATCGTTGAATCCATAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052891.1-507s1c1
Sequence:CCGGCCCAGGTATATTCAGCCACTTCTCGAGAAGTGGCTGAATATACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052891.1-230s1c1
Sequence:CCGGGCAGAGCGTTTGCAGCCAGATCTCGAGATCTGGCTGCAAACGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052891.1-1000s21c1
Sequence:CCGGACAGTGACGTGGTCAACATCCCTCGAGGGATGTTGACCACGTCACTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052891.1-654s21c1
Sequence:CCGGGCCAAATATGTCATCATCATCCTCGAGGATGATGATGACATATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052891
PGLYRP3 MISSION shRNA shRNA Plasmid DNA
peptidoglycan recognition protein 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052891.1-723s1c1
Sequence:CCGGGTCCGAAACATACAGTCCTTTCTCGAGAAAGGACTGTATGTTTCGGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000056750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052891.1-403s1c1
Sequence:CCGGGCATCGCCTTCTTTGGCAATACTCGAGTATTGCCAAAGAAGGCGATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000056751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052891.1-845s1c1
Sequence:CCGGCACTTATGGATTCAACGATATCTCGAGATATCGTTGAATCCATAAGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000056748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052891.1-507s1c1
Sequence:CCGGCCCAGGTATATTCAGCCACTTCTCGAGAAGTGGCTGAATATACCTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000056752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052891.1-230s1c1
Sequence:CCGGGCAGAGCGTTTGCAGCCAGATCTCGAGATCTGGCTGCAAACGCTCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000437709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052891.1-1000s21c1
Sequence:CCGGACAGTGACGTGGTCAACATCCCTCGAGGGATGTTGACCACGTCACTGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000425950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052891.1-654s21c1
Sequence:CCGGGCCAAATATGTCATCATCATCCTCGAGGATGATGATGACATATTTGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052891
PGLYRP3 MISSION shRNA Lentiviral Transduction Particles
peptidoglycan recognition protein 3
Human
7 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000056749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052891.1-723s1c1
Sequence:CCGGGTCCGAAACATACAGTCCTTTCTCGAGAAAGGACTGTATGTTTCGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052891.1-403s1c1
Sequence:CCGGGCATCGCCTTCTTTGGCAATACTCGAGTATTGCCAAAGAAGGCGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052891.1-845s1c1
Sequence:CCGGCACTTATGGATTCAACGATATCTCGAGATATCGTTGAATCCATAAGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052891.1-507s1c1
Sequence:CCGGCCCAGGTATATTCAGCCACTTCTCGAGAAGTGGCTGAATATACCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052891.1-230s1c1
Sequence:CCGGGCAGAGCGTTTGCAGCCAGATCTCGAGATCTGGCTGCAAACGCTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052891.1-1000s21c1
Sequence:CCGGACAGTGACGTGGTCAACATCCCTCGAGGGATGTTGACCACGTCACTGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052891.1-654s21c1
Sequence:CCGGGCCAAATATGTCATCATCATCCTCGAGGATGATGATGACATATTTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207247
PGLYRP3 MISSION shRNA Bacterial Glycerol Stock
peptidoglycan recognition protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207247.1-391s1c1
Sequence:CCGGGCCTTCTTTGGCAGTAAGATACTCGAGTATCTTACTGCCAAAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207247.1-837s1c1
Sequence:CCGGCAACGATATTGCTCTAGGAATCTCGAGATTCCTAGAGCAATATCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207247.1-685s1c1
Sequence:CCGGGCAGACTGTTTGGTTCGTGTACTCGAGTACACGAACCAAACAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207247.1-96s1c1
Sequence:CCGGCCCAACCATAGTTTCCAGAAACTCGAGTTTCTGGAAACTATGGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207247.1-487s1c1
Sequence:CCGGCCCAAGTACACTCAGCCATTTCTCGAGAAATGGCTGAGTGTACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207247
PGLYRP3 MISSION shRNA shRNA Plasmid DNA
peptidoglycan recognition protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207247.1-391s1c1
Sequence:CCGGGCCTTCTTTGGCAGTAAGATACTCGAGTATCTTACTGCCAAAGAAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000065502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207247.1-837s1c1
Sequence:CCGGCAACGATATTGCTCTAGGAATCTCGAGATTCCTAGAGCAATATCGTTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000065498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207247.1-685s1c1
Sequence:CCGGGCAGACTGTTTGGTTCGTGTACTCGAGTACACGAACCAAACAGTCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000065501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207247.1-96s1c1
Sequence:CCGGCCCAACCATAGTTTCCAGAAACTCGAGTTTCTGGAAACTATGGTTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000065500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207247.1-487s1c1
Sequence:CCGGCCCAAGTACACTCAGCCATTTCTCGAGAAATGGCTGAGTGTACTTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207247
PGLYRP3 MISSION shRNA Lentiviral Transduction Particles
peptidoglycan recognition protein 3
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000065499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207247.1-391s1c1
Sequence:CCGGGCCTTCTTTGGCAGTAAGATACTCGAGTATCTTACTGCCAAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207247.1-837s1c1
Sequence:CCGGCAACGATATTGCTCTAGGAATCTCGAGATTCCTAGAGCAATATCGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207247.1-685s1c1
Sequence:CCGGGCAGACTGTTTGGTTCGTGTACTCGAGTACACGAACCAAACAGTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207247.1-96s1c1
Sequence:CCGGCCCAACCATAGTTTCCAGAAACTCGAGTTTCTGGAAACTATGGTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207247.1-487s1c1
Sequence:CCGGCCCAAGTACACTCAGCCATTTCTCGAGAAATGGCTGAGTGTACTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)