EMAIL THIS PAGE TO A FRIEND

PGLYRP4

peptidoglycan recognition protein 4

75 Gene Product Result for
Synonyms: PGLYRPIbeta PGRP-Ibeta PGRPIB
Gene ID:
Human(57115) Summary: Peptidoglycan recognition proteins, such as PGRPI-beta, are part of the innate immune system and recognize peptidoglycan, a ubiquitous component of bacterial cell walls.[supplied by OMIM, Apr 2004]
Mouse(384997) peptidoglycan recognition protein 4
Rat(310611) peptidoglycan recognition protein 4
domestic guinea pig(100734955) peptidoglycan recognition protein 4
naked mole-rat(101719147) peptidoglycan recognition protein 4
cow(616843) peptidoglycan recognition protein 4
sheep(101103360) peptidoglycan recognition protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305802 ANTI-PGLYRP4 (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1635 Human PGLYRP4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020393 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207263 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207263 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207263 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082831 MISSION® esiRNA esiRNA human PGLYRP4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020393 Rosetta Predictions human pricing
XM_227383 Rosetta Predictions rat pricing
NM_207263 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069482 predicted 283
2 SASI_Hs01_00069483 predicted 1014
3 SASI_Hs01_00069484 predicted 467
4 SASI_Hs01_00069485 predicted 1106
5 SASI_Hs01_00069487 predicted 867
6 SASI_Hs01_00069488 predicted 602
7 SASI_Hs01_00069489 predicted 361
8 SASI_Hs02_00353365 predicted 1199
9 SASI_Hs02_00353366 predicted 829
10 SASI_Hs01_00069490 predicted 258
11 SASI_Hs01_00069486 predicted 622
12 SASI_Hs01_00069491 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384351 predicted 362
2 SASI_Rn02_00384352 predicted 832
3 SASI_Rn02_00384353 predicted 463
4 SASI_Rn02_00384354 predicted 334
5 SASI_Rn02_00384355 predicted 403
6 SASI_Rn02_00384356 predicted 828
7 SASI_Rn02_00384357 predicted 325
8 SASI_Rn02_00384358 predicted 821
9 SASI_Rn02_00384359 predicted 721
10 SASI_Rn02_00384360 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087752 predicted 698
2 SASI_Mm01_00087753 predicted 377
3 SASI_Mm01_00087754 predicted 297
4 SASI_Mm02_00352005 predicted 804
5 SASI_Mm01_00087755 predicted 676
6 SASI_Mm01_00087756 predicted 338
7 SASI_Mm01_00087757 predicted 867
8 SASI_Mm01_00087758 predicted 800
9 SASI_Mm01_00087759 predicted 262
10 SASI_Mm01_00087760 predicted 772
11 SASI_Mm01_00087761 predicted 904
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020393
PGLYRP4 MISSION shRNA Bacterial Glycerol Stock
peptidoglycan recognition protein 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020393.2-1471s21c1
Sequence:CCGGGGGCTGGTTCTTGTTTCATTTCTCGAGAAATGAAACAAGAACCAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020393.2-869s21c1
Sequence:CCGGGTCATGCGACATTGGTTATAACTCGAGTTATAACCAATGTCGCATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020393.2-1635s21c1
Sequence:CCGGTTTGGATGTAGCCCTTATTTACTCGAGTAAATAAGGGCTACATCCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020393.2-1612s21c1
Sequence:CCGGGCTTACACATAAACTTGTATACTCGAGTATACAAGTTTATGTGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020393.1-616s1c1
Sequence:CCGGCCACCTGTCATCCAGTTATGTCTCGAGACATAACTGGATGACAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020393.1-299s1c1
Sequence:CCGGCCAGTGAATGTCCTTGTTATACTCGAGTATAACAAGGACATTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020393.1-767s1c1
Sequence:CCGGCCAGCGAAGTATGGCATCATTCTCGAGAATGATGCCATACTTCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020393.1-187s1c1
Sequence:CCGGCCAGTACCTATTTGAGAACATCTCGAGATGTTCTCAAATAGGTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020393
PGLYRP4 MISSION shRNA shRNA Plasmid DNA
peptidoglycan recognition protein 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020393.2-1471s21c1
Sequence:CCGGGGGCTGGTTCTTGTTTCATTTCTCGAGAAATGAAACAAGAACCAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020393.2-869s21c1
Sequence:CCGGGTCATGCGACATTGGTTATAACTCGAGTTATAACCAATGTCGCATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020393.2-1635s21c1
Sequence:CCGGTTTGGATGTAGCCCTTATTTACTCGAGTAAATAAGGGCTACATCCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020393.2-1612s21c1
Sequence:CCGGGCTTACACATAAACTTGTATACTCGAGTATACAAGTTTATGTGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020393.1-616s1c1
Sequence:CCGGCCACCTGTCATCCAGTTATGTCTCGAGACATAACTGGATGACAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020393.1-299s1c1
Sequence:CCGGCCAGTGAATGTCCTTGTTATACTCGAGTATAACAAGGACATTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020393.1-767s1c1
Sequence:CCGGCCAGCGAAGTATGGCATCATTCTCGAGAATGATGCCATACTTCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020393.1-187s1c1
Sequence:CCGGCCAGTACCTATTTGAGAACATCTCGAGATGTTCTCAAATAGGTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020393
PGLYRP4 MISSION shRNA Lentiviral Transduction Particles
peptidoglycan recognition protein 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020393.2-1471s21c1
Sequence:CCGGGGGCTGGTTCTTGTTTCATTTCTCGAGAAATGAAACAAGAACCAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020393.2-869s21c1
Sequence:CCGGGTCATGCGACATTGGTTATAACTCGAGTTATAACCAATGTCGCATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020393.2-1635s21c1
Sequence:CCGGTTTGGATGTAGCCCTTATTTACTCGAGTAAATAAGGGCTACATCCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020393.2-1612s21c1
Sequence:CCGGGCTTACACATAAACTTGTATACTCGAGTATACAAGTTTATGTGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020393.1-616s1c1
Sequence:CCGGCCACCTGTCATCCAGTTATGTCTCGAGACATAACTGGATGACAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020393.1-299s1c1
Sequence:CCGGCCAGTGAATGTCCTTGTTATACTCGAGTATAACAAGGACATTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020393.1-767s1c1
Sequence:CCGGCCAGCGAAGTATGGCATCATTCTCGAGAATGATGCCATACTTCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020393.1-187s1c1
Sequence:CCGGCCAGTACCTATTTGAGAACATCTCGAGATGTTCTCAAATAGGTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207263
PGLYRP4 MISSION shRNA Bacterial Glycerol Stock
peptidoglycan recognition protein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207263.1-149s1c1
Sequence:CCGGGCCGTGATGATGTCTTCACTACTCGAGTAGTGAAGACATCATCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207263.1-903s1c1
Sequence:CCGGCAATGACATCTCTTTGAGTATCTCGAGATACTCAAAGAGATGTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207263.1-697s1c1
Sequence:CCGGCCTGCGAAGTATGCCATCATTCTCGAGAATGATGGCATACTTCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207263.1-99s1c1
Sequence:CCGGGCAGCAACTGTTTGGCAACATCTCGAGATGTTGCCAAACAGTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207263.1-229s1c1
Sequence:CCGGCCAGTGGATGTCCTTGTCATACTCGAGTATGACAAGGACATCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207263
PGLYRP4 MISSION shRNA shRNA Plasmid DNA
peptidoglycan recognition protein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207263.1-149s1c1
Sequence:CCGGGCCGTGATGATGTCTTCACTACTCGAGTAGTGAAGACATCATCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207263.1-903s1c1
Sequence:CCGGCAATGACATCTCTTTGAGTATCTCGAGATACTCAAAGAGATGTCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207263.1-697s1c1
Sequence:CCGGCCTGCGAAGTATGCCATCATTCTCGAGAATGATGGCATACTTCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207263.1-99s1c1
Sequence:CCGGGCAGCAACTGTTTGGCAACATCTCGAGATGTTGCCAAACAGTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207263.1-229s1c1
Sequence:CCGGCCAGTGGATGTCCTTGTCATACTCGAGTATGACAAGGACATCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207263
PGLYRP4 MISSION shRNA Lentiviral Transduction Particles
peptidoglycan recognition protein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207263.1-149s1c1
Sequence:CCGGGCCGTGATGATGTCTTCACTACTCGAGTAGTGAAGACATCATCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207263.1-903s1c1
Sequence:CCGGCAATGACATCTCTTTGAGTATCTCGAGATACTCAAAGAGATGTCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207263.1-697s1c1
Sequence:CCGGCCTGCGAAGTATGCCATCATTCTCGAGAATGATGGCATACTTCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207263.1-99s1c1
Sequence:CCGGGCAGCAACTGTTTGGCAACATCTCGAGATGTTGCCAAACAGTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207263.1-229s1c1
Sequence:CCGGCCAGTGGATGTCCTTGTCATACTCGAGTATGACAAGGACATCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)