EMAIL THIS PAGE TO A FRIEND

PGM1

phosphoglucomutase 1

98 Gene Product Result for
Synonyms: CDG1T GSD14
Gene ID:
Human(5236) Summary: The protein encoded by this gene is an isozyme of phosphoglucomutase (PGM) and belongs to the phosphohexose mutase family. There are several PGM isozymes, which are encoded by different genes and catalyze the transfer of phosphate between the 1 and 6 positions of glucose. In most cell types, this PGM isozyme is predominant, representing about 90% of total PGM activity. In red cells, PGM2 is a major isozyme. This gene is highly polymorphic. Mutations in this gene cause glycogen storage disease type 14. Alternativley spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Mar 2010]
Mouse(66681) phosphoglucomutase 1
Rat(24645) phosphoglucomutase 1
Zebrafish(394000) phosphoglucomutase 1
chicken(424691) phosphoglucomutase 1
dog(479545) phosphoglucomutase 1
domestic cat(101083353) phosphoglucomutase 1
cow(534402) phosphoglucomutase 1
sheep(101109225) phosphoglucomutase 1
naked mole-rat(101711743) phosphoglucomutase 1
Domestic Rabbit(100009155) phosphoglucomutase 1
domestic guinea pig(100721478) phosphoglucomutase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002633 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025700 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025700 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025700 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061401 MISSION® esiRNA targeting human PGM1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002633 Rosetta Predictions human pricing
NM_017033 Rosetta Predictions rat pricing
NM_025700 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122728 predicted 856
2 SASI_Hs01_00122731 predicted 1554
3 SASI_Hs01_00122732 predicted 795
4 SASI_Hs02_00334153 predicted 1888
5 SASI_Hs01_00122733 predicted 1255
6 SASI_Hs01_00122734 predicted 695
7 SASI_Hs02_00334154 predicted 791
8 SASI_Hs01_00122735 predicted 947
9 SASI_Hs01_00122736 predicted 764
10 SASI_Hs01_00122737 predicted 225
11 SASI_Hs01_00122729 predicted 803
12 SASI_Hs01_00122730 predicted 1652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017033 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073076 predicted 653
2 SASI_Rn01_00073077 predicted 1545
3 SASI_Rn01_00073078 predicted 1094
4 SASI_Rn01_00073079 predicted 523
5 SASI_Rn01_00073080 predicted 1473
6 SASI_Rn01_00073081 predicted 1488
7 SASI_Rn01_00073082 predicted 1165
8 SASI_Rn01_00073083 predicted 351
9 SASI_Rn01_00073084 predicted 1433
10 SASI_Rn02_00261213 predicted 660
11 SASI_Rn01_00073085 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073278 predicted 1477
2 SASI_Mm01_00073279 predicted 677
3 SASI_Mm01_00073280 predicted 459
4 SASI_Mm01_00073281 predicted 1333
5 SASI_Mm01_00073282 predicted 1327
6 SASI_Mm01_00073283 predicted 1556
7 SASI_Mm01_00073284 predicted 734
8 SASI_Mm01_00073285 predicted 907
9 SASI_Mm01_00073286 predicted 949
10 SASI_Mm01_00073287 predicted 1672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002633
VALIDATED
PGM1 MISSION shRNA Bacterial Glycerol Stock
phosphoglucomutase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002633.2-862s1c1
Sequence:CCGGCGACTGAAGATCCGTATTGATCTCGAGATCAATACGGATCTTCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002633.2-1153s1c1
Sequence:CCGGGCTGCCAACATCTTCAGCATTCTCGAGAATGCTGAAGATGTTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002633.2-694s1c1
Sequence:CCGGCCTGACCTGAAAGTAGACCTTCTCGAGAAGGTCTACTTTCAGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002633.2-1756s1c1
Sequence:CCGGCGGCTGTACATCGATAGCTATCTCGAGATAGCTATCGATGTACAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002633.2-466s1c1
Sequence:CCGGCGCTTGGTTATCGGACAGAATCTCGAGATTCTGTCCGATAACCAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002633.2-862s21c1
Sequence:CCGGCGACTGAAGATCCGTATTGATCTCGAGATCAATACGGATCTTCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002633.2-694s21c1
Sequence:CCGGCCTGACCTGAAAGTAGACCTTCTCGAGAAGGTCTACTTTCAGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002633.2-1153s21c1
Sequence:CCGGGCTGCCAACATCTTCAGCATTCTCGAGAATGCTGAAGATGTTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002633.2-1756s21c1
Sequence:CCGGCGGCTGTACATCGATAGCTATCTCGAGATAGCTATCGATGTACAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002633.2-466s21c1
Sequence:CCGGCGCTTGGTTATCGGACAGAATCTCGAGATTCTGTCCGATAACCAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002633
VALIDATED
PGM1 MISSION shRNA shRNA Plasmid DNA
phosphoglucomutase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002633.2-862s1c1
Sequence:CCGGCGACTGAAGATCCGTATTGATCTCGAGATCAATACGGATCTTCAGTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000049051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002633.2-1153s1c1
Sequence:CCGGGCTGCCAACATCTTCAGCATTCTCGAGAATGCTGAAGATGTTGGCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000049052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002633.2-694s1c1
Sequence:CCGGCCTGACCTGAAAGTAGACCTTCTCGAGAAGGTCTACTTTCAGGTCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000049049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002633.2-1756s1c1
Sequence:CCGGCGGCTGTACATCGATAGCTATCTCGAGATAGCTATCGATGTACAGCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000049048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002633.2-466s1c1
Sequence:CCGGCGCTTGGTTATCGGACAGAATCTCGAGATTCTGTCCGATAACCAAGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000300521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002633.2-862s21c1
Sequence:CCGGCGACTGAAGATCCGTATTGATCTCGAGATCAATACGGATCTTCAGTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000331313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002633.2-694s21c1
Sequence:CCGGCCTGACCTGAAAGTAGACCTTCTCGAGAAGGTCTACTTTCAGGTCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000300592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002633.2-1153s21c1
Sequence:CCGGGCTGCCAACATCTTCAGCATTCTCGAGAATGCTGAAGATGTTGGCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000300589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002633.2-1756s21c1
Sequence:CCGGCGGCTGTACATCGATAGCTATCTCGAGATAGCTATCGATGTACAGCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000300593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002633.2-466s21c1
Sequence:CCGGCGCTTGGTTATCGGACAGAATCTCGAGATTCTGTCCGATAACCAAGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002633
VALIDATED
PGM1 MISSION shRNA Lentiviral Transduction Particles
phosphoglucomutase 1
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000049050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002633.2-862s1c1
Sequence:CCGGCGACTGAAGATCCGTATTGATCTCGAGATCAATACGGATCTTCAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002633.2-1153s1c1
Sequence:CCGGGCTGCCAACATCTTCAGCATTCTCGAGAATGCTGAAGATGTTGGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002633.2-694s1c1
Sequence:CCGGCCTGACCTGAAAGTAGACCTTCTCGAGAAGGTCTACTTTCAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002633.2-1756s1c1
Sequence:CCGGCGGCTGTACATCGATAGCTATCTCGAGATAGCTATCGATGTACAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002633.2-466s1c1
Sequence:CCGGCGCTTGGTTATCGGACAGAATCTCGAGATTCTGTCCGATAACCAAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002633.2-862s21c1
Sequence:CCGGCGACTGAAGATCCGTATTGATCTCGAGATCAATACGGATCTTCAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002633.2-694s21c1
Sequence:CCGGCCTGACCTGAAAGTAGACCTTCTCGAGAAGGTCTACTTTCAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002633.2-1153s21c1
Sequence:CCGGGCTGCCAACATCTTCAGCATTCTCGAGAATGCTGAAGATGTTGGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002633.2-1756s21c1
Sequence:CCGGCGGCTGTACATCGATAGCTATCTCGAGATAGCTATCGATGTACAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002633.2-466s21c1
Sequence:CCGGCGCTTGGTTATCGGACAGAATCTCGAGATTCTGTCCGATAACCAAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025700
VALIDATED
PGM1 MISSION shRNA Bacterial Glycerol Stock
phosphoglucomutase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025700.2-540s21c1
Sequence:CCGGTGATCACTGCCTCGCACAATCCTCGAGGATTGTGCGAGGCAGTGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025700.2-1904s21c1
Sequence:CCGGCCAGTACTGGATAGGATTAAACTCGAGTTTAATCCTATCCAGTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025700.1-2019s1c1
Sequence:CCGGCAGCTCTATCTTCCTTGTGATCTCGAGATCACAAGGAAGATAGAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025700.2-169s21c1
Sequence:CCGGGCTCATTGCTGGAGGTAATAACTCGAGTTATTACCTCCAGCAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025700.1-923s1c1
Sequence:CCGGCCAACTGTCAAATACCCGAATCTCGAGATTCGGGTATTTGACAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025700.1-1476s1c1
Sequence:CCGGGCTATCATATTACCACAGCTTCTCGAGAAGCTGTGGTAATATGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025700.2-729s21c1
Sequence:CCGGCCATCGGTAATGACTACTTTGCTCGAGCAAAGTAGTCATTACCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025700.2-1467s21c1
Sequence:CCGGTGGAGTACGGCTATCATATTACTCGAGTAATATGATAGCCGTACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025700
VALIDATED
PGM1 MISSION shRNA shRNA Plasmid DNA
phosphoglucomutase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025700.2-540s21c1
Sequence:CCGGTGATCACTGCCTCGCACAATCCTCGAGGATTGTGCGAGGCAGTGATCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000247389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025700.2-1904s21c1
Sequence:CCGGCCAGTACTGGATAGGATTAAACTCGAGTTTAATCCTATCCAGTACTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000193054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025700.1-2019s1c1
Sequence:CCGGCAGCTCTATCTTCCTTGTGATCTCGAGATCACAAGGAAGATAGAGCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000247387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025700.2-169s21c1
Sequence:CCGGGCTCATTGCTGGAGGTAATAACTCGAGTTATTACCTCCAGCAATGAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000192366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025700.1-923s1c1
Sequence:CCGGCCAACTGTCAAATACCCGAATCTCGAGATTCGGGTATTTGACAGTTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000191633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025700.1-1476s1c1
Sequence:CCGGGCTATCATATTACCACAGCTTCTCGAGAAGCTGTGGTAATATGATAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000247386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025700.2-729s21c1
Sequence:CCGGCCATCGGTAATGACTACTTTGCTCGAGCAAAGTAGTCATTACCGATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000247385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025700.2-1467s21c1
Sequence:CCGGTGGAGTACGGCTATCATATTACTCGAGTAATATGATAGCCGTACTCCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025700
VALIDATED
PGM1 MISSION shRNA Lentiviral Transduction Particles
phosphoglucomutase 1
Mouse
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000247388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025700.2-540s21c1
Sequence:CCGGTGATCACTGCCTCGCACAATCCTCGAGGATTGTGCGAGGCAGTGATCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025700.2-1904s21c1
Sequence:CCGGCCAGTACTGGATAGGATTAAACTCGAGTTTAATCCTATCCAGTACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193054    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025700.1-2019s1c1
Sequence:CCGGCAGCTCTATCTTCCTTGTGATCTCGAGATCACAAGGAAGATAGAGCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025700.2-169s21c1
Sequence:CCGGGCTCATTGCTGGAGGTAATAACTCGAGTTATTACCTCCAGCAATGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025700.1-923s1c1
Sequence:CCGGCCAACTGTCAAATACCCGAATCTCGAGATTCGGGTATTTGACAGTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025700.1-1476s1c1
Sequence:CCGGGCTATCATATTACCACAGCTTCTCGAGAAGCTGTGGTAATATGATAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025700.2-729s21c1
Sequence:CCGGCCATCGGTAATGACTACTTTGCTCGAGCAAAGTAGTCATTACCGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025700.2-1467s21c1
Sequence:CCGGTGGAGTACGGCTATCATATTACTCGAGTAATATGATAGCCGTACTCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)