EMAIL THIS PAGE TO A FRIEND

PGM2

phosphoglucomutase 2

61 Gene Product Result for
UniProtKB ID: Q96G03, Q53FP5, Q5QTR0, Q9H0P9, Q9NV22
Gene ID:
Mouse(72157) phosphoglucomutase 2
Rat(289632) phosphoglucomutase 2
domestic guinea pig(100731750) phosphoglucomutase 2
Domestic Rabbit(100351563) phosphoglucomutase 2
naked mole-rat(101712721) phosphoglucomutase 2
cow(506980) phosphoglucomutase 2
sheep(101111285) phosphoglucomutase 2
Zebrafish(405822) phosphoglucomutase 2
domestic cat(101095577) phosphoglucomutase 2
dog(479116) phosphoglucomutase 2
chicken(776748) phosphoglucomutase 2
chicken(426435) phosphoglucomutase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018290 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028132 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028132 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028132 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018290 Rosetta Predictions human pricing
NM_001106007 Rosetta Predictions rat pricing
NM_028132 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023956 predicted 690
2 SASI_Hs01_00023957 predicted 1790
3 SASI_Hs01_00023958 predicted 1862
4 SASI_Hs01_00023959 predicted 1572
5 SASI_Hs01_00023960 predicted 1559
6 SASI_Hs02_00351675 predicted 502
7 SASI_Hs01_00023962 predicted 1231
8 SASI_Hs01_00023963 predicted 963
9 SASI_Hs01_00023965 predicted 876
10 SASI_Hs02_00351676 predicted 1400
11 SASI_Hs01_00023961 predicted 542
12 SASI_Hs01_00023964 predicted 1467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214712 predicted 1389
2 SASI_Rn02_00214713 predicted 1354
3 SASI_Rn02_00214714 predicted 1173
4 SASI_Rn02_00214715 predicted 1247
5 SASI_Rn02_00214716 predicted 1430
6 SASI_Rn02_00214717 predicted 1542
7 SASI_Rn02_00214718 predicted 1321
8 SASI_Rn02_00214719 predicted 1366
9 SASI_Rn02_00214720 predicted 1432
10 SASI_Rn02_00214721 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028132 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028214 predicted 1545
2 SASI_Mm01_00028215 predicted 346
3 SASI_Mm02_00333400 predicted 647
4 SASI_Mm01_00028216 predicted 849
5 SASI_Mm02_00333401 predicted 1467
6 SASI_Mm01_00028217 predicted 1777
7 SASI_Mm01_00028218 predicted 523
8 SASI_Mm02_00333402 predicted 1494
9 SASI_Mm02_00333403 predicted 657
10 SASI_Mm01_00028219 predicted 704
11 SASI_Mm01_00028220 predicted 1292
12 SASI_Mm01_00028221 predicted 885
13 SASI_Mm01_00028222 predicted 1597
14 SASI_Mm01_00028223 predicted 726
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018290
VALIDATED
PGM2 MISSION shRNA Bacterial Glycerol Stock
phosphoglucomutase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018290.3-1934s21c1
Sequence:CCGGCTTGCATTTACCTACAATTAACTCGAGTTAATTGTAGGTAAATGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018290.3-514s21c1
Sequence:CCGGGCCCTTCACAGTATCACATTTCTCGAGAAATGTGATACTGTGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018290.3-182s21c1
Sequence:CCGGCGACTAATAGCAGAAGGTAATCTCGAGATTACCTTCTGCTATTAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018290.3-929s21c1
Sequence:CCGGCCTGAGTTTCCAACAGTGAAACTCGAGTTTCACTGTTGGAAACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018290.3-1482s21c1
Sequence:CCGGTGGAGTATGGCTACCATATTACTCGAGTAATATGGTAGCCATACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018290.1-1504s1c1
Sequence:CCGGCCTCAGAAACTACGATGGAAACTCGAGTTTCCATCGTAGTTTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018290.1-125s1c1
Sequence:CCGGCGACTAATAGCAGAAGGTAATCTCGAGATTACCTTCTGCTATTAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018290.1-1345s1c1
Sequence:CCGGCGCTGTCATAAGTGCAGAGTTCTCGAGAACTCTGCACTTATGACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018290.1-457s1c1
Sequence:CCGGGCCCTTCACAGTATCACATTTCTCGAGAAATGTGATACTGTGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018290.1-872s1c1
Sequence:CCGGCCTGAGTTTCCAACAGTGAAACTCGAGTTTCACTGTTGGAAACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018290
VALIDATED
PGM2 MISSION shRNA shRNA Plasmid DNA
phosphoglucomutase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018290.3-1934s21c1
Sequence:CCGGCTTGCATTTACCTACAATTAACTCGAGTTAATTGTAGGTAAATGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018290.3-514s21c1
Sequence:CCGGGCCCTTCACAGTATCACATTTCTCGAGAAATGTGATACTGTGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018290.3-182s21c1
Sequence:CCGGCGACTAATAGCAGAAGGTAATCTCGAGATTACCTTCTGCTATTAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018290.3-929s21c1
Sequence:CCGGCCTGAGTTTCCAACAGTGAAACTCGAGTTTCACTGTTGGAAACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018290.3-1482s21c1
Sequence:CCGGTGGAGTATGGCTACCATATTACTCGAGTAATATGGTAGCCATACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018290.1-1504s1c1
Sequence:CCGGCCTCAGAAACTACGATGGAAACTCGAGTTTCCATCGTAGTTTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018290.1-125s1c1
Sequence:CCGGCGACTAATAGCAGAAGGTAATCTCGAGATTACCTTCTGCTATTAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018290.1-1345s1c1
Sequence:CCGGCGCTGTCATAAGTGCAGAGTTCTCGAGAACTCTGCACTTATGACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018290.1-457s1c1
Sequence:CCGGGCCCTTCACAGTATCACATTTCTCGAGAAATGTGATACTGTGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018290.1-872s1c1
Sequence:CCGGCCTGAGTTTCCAACAGTGAAACTCGAGTTTCACTGTTGGAAACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018290
VALIDATED
PGM2 MISSION shRNA Lentiviral Transduction Particles
phosphoglucomutase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018290.3-1934s21c1
Sequence:CCGGCTTGCATTTACCTACAATTAACTCGAGTTAATTGTAGGTAAATGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018290.3-514s21c1
Sequence:CCGGGCCCTTCACAGTATCACATTTCTCGAGAAATGTGATACTGTGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018290.3-182s21c1
Sequence:CCGGCGACTAATAGCAGAAGGTAATCTCGAGATTACCTTCTGCTATTAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018290.3-929s21c1
Sequence:CCGGCCTGAGTTTCCAACAGTGAAACTCGAGTTTCACTGTTGGAAACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018290.3-1482s21c1
Sequence:CCGGTGGAGTATGGCTACCATATTACTCGAGTAATATGGTAGCCATACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018290.1-1504s1c1
Sequence:CCGGCCTCAGAAACTACGATGGAAACTCGAGTTTCCATCGTAGTTTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018290.1-125s1c1
Sequence:CCGGCGACTAATAGCAGAAGGTAATCTCGAGATTACCTTCTGCTATTAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018290.1-1345s1c1
Sequence:CCGGCGCTGTCATAAGTGCAGAGTTCTCGAGAACTCTGCACTTATGACAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018290.1-457s1c1
Sequence:CCGGGCCCTTCACAGTATCACATTTCTCGAGAAATGTGATACTGTGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018290.1-872s1c1
Sequence:CCGGCCTGAGTTTCCAACAGTGAAACTCGAGTTTCACTGTTGGAAACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028132
VALIDATED
PGM2 MISSION shRNA Bacterial Glycerol Stock
phosphoglucomutase 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028132.2-1519s21c1
Sequence:CCGGATCAGGGCTTGCGGCTTATTTCTCGAGAAATAAGCCGCAAGCCCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028132.2-517s21c1
Sequence:CCGGCAATCGAAGAATATGCCATTTCTCGAGAAATGGCATATTCTTCGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028132.2-1593s21c1
Sequence:CCGGGCTACCATCCGGCTGTATATTCTCGAGAATATACAGCCGGATGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028132.2-1956s21c1
Sequence:CCGGTTCCTTCTCTTGCCCTATTAACTCGAGTTAATAGGGCAAGAGAAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028132.2-740s21c1
Sequence:CCGGAGTTGTGGGACCGTACGTAAACTCGAGTTTACGTACGGTCCCACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028132.2-1323s1c1
Sequence:CCGGCGGAACTTCTTTACCAGGTATCTCGAGATACCTGGTAAAGAAGTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028132
VALIDATED
PGM2 MISSION shRNA shRNA Plasmid DNA
phosphoglucomutase 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028132.2-1519s21c1
Sequence:CCGGATCAGGGCTTGCGGCTTATTTCTCGAGAAATAAGCCGCAAGCCCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028132.2-517s21c1
Sequence:CCGGCAATCGAAGAATATGCCATTTCTCGAGAAATGGCATATTCTTCGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028132.2-1593s21c1
Sequence:CCGGGCTACCATCCGGCTGTATATTCTCGAGAATATACAGCCGGATGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028132.2-1956s21c1
Sequence:CCGGTTCCTTCTCTTGCCCTATTAACTCGAGTTAATAGGGCAAGAGAAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028132.2-740s21c1
Sequence:CCGGAGTTGTGGGACCGTACGTAAACTCGAGTTTACGTACGGTCCCACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028132.2-1323s1c1
Sequence:CCGGCGGAACTTCTTTACCAGGTATCTCGAGATACCTGGTAAAGAAGTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028132
VALIDATED
PGM2 MISSION shRNA Lentiviral Transduction Particles
phosphoglucomutase 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028132.2-1519s21c1
Sequence:CCGGATCAGGGCTTGCGGCTTATTTCTCGAGAAATAAGCCGCAAGCCCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028132.2-517s21c1
Sequence:CCGGCAATCGAAGAATATGCCATTTCTCGAGAAATGGCATATTCTTCGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028132.2-1593s21c1
Sequence:CCGGGCTACCATCCGGCTGTATATTCTCGAGAATATACAGCCGGATGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247852    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028132.2-1956s21c1
Sequence:CCGGTTCCTTCTCTTGCCCTATTAACTCGAGTTAATAGGGCAAGAGAAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028132.2-740s21c1
Sequence:CCGGAGTTGTGGGACCGTACGTAAACTCGAGTTTACGTACGGTCCCACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028132.2-1323s1c1
Sequence:CCGGCGGAACTTCTTTACCAGGTATCTCGAGATACCTGGTAAAGAAGTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)