EMAIL THIS PAGE TO A FRIEND

PGM2L1

phosphoglucomutase 2-like 1

280 Gene Product Result for
Synonyms: BM32A
UniProtKB ID: Q6PCE3, Q96MQ7, Q9UIK3
Gene ID:
Mouse(70974) phosphoglucomutase 2-like 1
Rat(685076) phosphoglucomutase 2-like 1
Zebrafish(449945) phosphoglucomutase 2-like 1
domestic cat(101094697) phosphoglucomutase 2-like 1
Horse(100052026) phosphoglucomutase 2-like 1
dog(485198) phosphoglucomutase 2-like 1
chicken(419052) phosphoglucomutase 2-like 1
cow(515366) phosphoglucomutase 2-like 1
sheep(101106106) phosphoglucomutase 2-like 1
naked mole-rat(101710764) phosphoglucomutase 2-like 1
domestic guinea pig(100722597) phosphoglucomutase 2-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173582 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173582 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173582 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027629 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027629 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027629 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173582 Rosetta Predictions human pricing
NM_001109454 Rosetta Predictions rat pricing
NM_027629 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231081 predicted 1761
2 SASI_Hs01_00231082 predicted 1192
3 SASI_Hs01_00231083 predicted 835
4 SASI_Hs01_00231084 predicted 616
5 SASI_Hs01_00231085 predicted 1415
6 SASI_Hs01_00231086 predicted 1319
7 SASI_Hs01_00231087 predicted 710
8 SASI_Hs01_00231089 predicted 1065
9 SASI_Hs01_00231090 predicted 1003
10 SASI_Hs02_00368419 predicted 945
11 SASI_Hs01_00231088 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109454 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248567 predicted 1811
2 SASI_Rn02_00248568 predicted 1230
3 SASI_Rn02_00248569 predicted 1603
4 SASI_Rn02_00248570 predicted 465
5 SASI_Rn02_00248571 predicted 2078
6 SASI_Rn02_00248572 predicted 1723
7 SASI_Rn02_00248573 predicted 815
8 SASI_Rn02_00248574 predicted 1888
9 SASI_Rn02_00248575 predicted 1904
10 SASI_Rn02_00248576 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027629 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169665 predicted 1616
2 SASI_Mm01_00169666 predicted 1371
3 SASI_Mm01_00169668 predicted 893
4 SASI_Mm01_00169669 predicted 600
5 SASI_Mm01_00169670 predicted 1893
6 SASI_Mm01_00169671 predicted 1819
7 SASI_Mm01_00169672 predicted 817
8 SASI_Mm01_00169673 predicted 1921
9 SASI_Mm01_00169674 predicted 555
10 SASI_Mm02_00332499 predicted 1843
11 SASI_Mm01_00169667 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173582
VALIDATED
PGM2L1 MISSION shRNA Bacterial Glycerol Stock
phosphoglucomutase 2-like 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173582.2-1059s1c1
Sequence:CCGGCGGACATGACTATGTGCAGTTCTCGAGAACTGCACATAGTCATGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173582.2-786s1c1
Sequence:CCGGCCGCAAGGAAGACAATGGATACTCGAGTATCCATTGTCTTCCTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_173582.2-1447s1c1
Sequence:CCGGGCACTTAAAGAAGGATTTCATCTCGAGATGAAATCCTTCTTTAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173582.2-2088s1c1
Sequence:CCGGGCCTAGTAAGAATGGACTGATCTCGAGATCAGTCCATTCTTACTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173582.2-355s1c1
Sequence:CCGGCGCTGGGATAAGAATCCCAAACTCGAGTTTGGGATTCTTATCCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173582.3-793s21c1
Sequence:CCGGCAGTTGCAGGTGTGATGATTACTCGAGTAATCATCACACCTGCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173582.3-875s21c1
Sequence:CCGGGATCACATCTCCTCATGATAACTCGAGTTATCATGAGGAGATGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173582.3-1535s21c1
Sequence:CCGCATGGATTGGAAGTAGGATAATCTCGAGATTATCCTACTTCCAATCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173582.3-1804s21c1
Sequence:CCGCTATTTGAAAGGCTTCGTAATTCTCGAGAATTACGAAGCCTTTCAAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173582.3-2643s21c1
Sequence:CCGGTGTGACATCACAGGTATTAATCTCGAGATTAATACCTGTGATGTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173582.3-544s21c1
Sequence:CCGGTTAATGACCTTACAGTAATACCTCGAGGTATTACTGTAAGGTCATTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173582
VALIDATED
PGM2L1 MISSION shRNA shRNA Plasmid DNA
phosphoglucomutase 2-like 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173582.2-1059s1c1
Sequence:CCGGCGGACATGACTATGTGCAGTTCTCGAGAACTGCACATAGTCATGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173582.2-786s1c1
Sequence:CCGGCCGCAAGGAAGACAATGGATACTCGAGTATCCATTGTCTTCCTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_173582.2-1447s1c1
Sequence:CCGGGCACTTAAAGAAGGATTTCATCTCGAGATGAAATCCTTCTTTAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173582.2-2088s1c1
Sequence:CCGGGCCTAGTAAGAATGGACTGATCTCGAGATCAGTCCATTCTTACTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173582.2-355s1c1
Sequence:CCGGCGCTGGGATAAGAATCCCAAACTCGAGTTTGGGATTCTTATCCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173582.3-793s21c1
Sequence:CCGGCAGTTGCAGGTGTGATGATTACTCGAGTAATCATCACACCTGCAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173582.3-875s21c1
Sequence:CCGGGATCACATCTCCTCATGATAACTCGAGTTATCATGAGGAGATGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173582.3-1535s21c1
Sequence:CCGCATGGATTGGAAGTAGGATAATCTCGAGATTATCCTACTTCCAATCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173582.3-1804s21c1
Sequence:CCGCTATTTGAAAGGCTTCGTAATTCTCGAGAATTACGAAGCCTTTCAAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173582.3-2643s21c1
Sequence:CCGGTGTGACATCACAGGTATTAATCTCGAGATTAATACCTGTGATGTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173582.3-544s21c1
Sequence:CCGGTTAATGACCTTACAGTAATACCTCGAGGTATTACTGTAAGGTCATTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173582
VALIDATED
PGM2L1 MISSION shRNA Lentiviral Transduction Particles
phosphoglucomutase 2-like 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173582.2-1059s1c1
Sequence:CCGGCGGACATGACTATGTGCAGTTCTCGAGAACTGCACATAGTCATGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173582.2-786s1c1
Sequence:CCGGCCGCAAGGAAGACAATGGATACTCGAGTATCCATTGTCTTCCTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_173582.2-1447s1c1
Sequence:CCGGGCACTTAAAGAAGGATTTCATCTCGAGATGAAATCCTTCTTTAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173582.2-2088s1c1
Sequence:CCGGGCCTAGTAAGAATGGACTGATCTCGAGATCAGTCCATTCTTACTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173582.2-355s1c1
Sequence:CCGGCGCTGGGATAAGAATCCCAAACTCGAGTTTGGGATTCTTATCCCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173582.3-793s21c1
Sequence:CCGGCAGTTGCAGGTGTGATGATTACTCGAGTAATCATCACACCTGCAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173582.3-875s21c1
Sequence:CCGGGATCACATCTCCTCATGATAACTCGAGTTATCATGAGGAGATGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173582.3-1535s21c1
Sequence:CCGCATGGATTGGAAGTAGGATAATCTCGAGATTATCCTACTTCCAATCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173582.3-1804s21c1
Sequence:CCGCTATTTGAAAGGCTTCGTAATTCTCGAGAATTACGAAGCCTTTCAAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173582.3-2643s21c1
Sequence:CCGGTGTGACATCACAGGTATTAATCTCGAGATTAATACCTGTGATGTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173582.3-544s21c1
Sequence:CCGGTTAATGACCTTACAGTAATACCTCGAGGTATTACTGTAAGGTCATTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027629
VALIDATED
PGM2L1 MISSION shRNA Bacterial Glycerol Stock
phosphoglucomutase 2-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027629.1-401s1c1
Sequence:CCGGCGTTGGGACAAGAATCCCAAACTCGAGTTTGGGATTCTTGTCCCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191487    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027629.1-4905s1c1
Sequence:CCGGGCTGTTTACTTGTGTTTGTTACTCGAGTAACAAACACAAGTAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202012    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027629.1-4863s1c1
Sequence:CCGGCGTGCAAACATGCACCGTAATCTCGAGATTACGGTGCATGTTTGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027629.3-1904s1c1
Sequence:CCGGCATAACCACTGGATATGATAGCTCGAGCTATCATATCCAGTGGTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027629.3-3530s21c1
Sequence:CCGGGTTAGAACTAAGGTCAATTTACTCGAGTAAATTGACCTTAGTTCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027629.3-1553s21c1
Sequence:CCGGATGGATTGGAAGTAGGATAAACTCGAGTTTATCCTACTTCCAATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027629.3-1904s21c1
Sequence:CCGGCATAACCACTGGATATGATAGCTCGAGCTATCATATCCAGTGGTTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027629.3-774s21c1
Sequence:CCGGCCTACACCTTTCGTACCATATCTCGAGATATGGTACGAAAGGTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027629.3-2181s21c1
Sequence:CCGGTAGGGCACATCAGTACGTTATCTCGAGATAACGTACTGATGTGCCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027629
VALIDATED
PGM2L1 MISSION shRNA shRNA Plasmid DNA
phosphoglucomutase 2-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027629.1-401s1c1
Sequence:CCGGCGTTGGGACAAGAATCCCAAACTCGAGTTTGGGATTCTTGTCCCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191487    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027629.1-4905s1c1
Sequence:CCGGGCTGTTTACTTGTGTTTGTTACTCGAGTAACAAACACAAGTAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202012    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027629.1-4863s1c1
Sequence:CCGGCGTGCAAACATGCACCGTAATCTCGAGATTACGGTGCATGTTTGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027629.3-1904s1c1
Sequence:CCGGCATAACCACTGGATATGATAGCTCGAGCTATCATATCCAGTGGTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027629.3-3530s21c1
Sequence:CCGGGTTAGAACTAAGGTCAATTTACTCGAGTAAATTGACCTTAGTTCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027629.3-1553s21c1
Sequence:CCGGATGGATTGGAAGTAGGATAAACTCGAGTTTATCCTACTTCCAATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027629.3-1904s21c1
Sequence:CCGGCATAACCACTGGATATGATAGCTCGAGCTATCATATCCAGTGGTTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027629.3-774s21c1
Sequence:CCGGCCTACACCTTTCGTACCATATCTCGAGATATGGTACGAAAGGTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027629.3-2181s21c1
Sequence:CCGGTAGGGCACATCAGTACGTTATCTCGAGATAACGTACTGATGTGCCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027629
VALIDATED
PGM2L1 MISSION shRNA Lentiviral Transduction Particles
phosphoglucomutase 2-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027629.1-401s1c1
Sequence:CCGGCGTTGGGACAAGAATCCCAAACTCGAGTTTGGGATTCTTGTCCCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191487    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027629.1-4905s1c1
Sequence:CCGGGCTGTTTACTTGTGTTTGTTACTCGAGTAACAAACACAAGTAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202012    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027629.1-4863s1c1
Sequence:CCGGCGTGCAAACATGCACCGTAATCTCGAGATTACGGTGCATGTTTGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027629.3-1904s1c1
Sequence:CCGGCATAACCACTGGATATGATAGCTCGAGCTATCATATCCAGTGGTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027629.3-3530s21c1
Sequence:CCGGGTTAGAACTAAGGTCAATTTACTCGAGTAAATTGACCTTAGTTCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027629.3-1553s21c1
Sequence:CCGGATGGATTGGAAGTAGGATAAACTCGAGTTTATCCTACTTCCAATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027629.3-1904s21c1
Sequence:CCGGCATAACCACTGGATATGATAGCTCGAGCTATCATATCCAGTGGTTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027629.3-774s21c1
Sequence:CCGGCCTACACCTTTCGTACCATATCTCGAGATATGGTACGAAAGGTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027629.3-2181s21c1
Sequence:CCGGTAGGGCACATCAGTACGTTATCTCGAGATAACGTACTGATGTGCCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)