EMAIL THIS PAGE TO A FRIEND

PGM3

phosphoglucomutase 3

48 Gene Product Result for
Synonyms: AGM1 PAGM PGM 3
Gene ID:
Human(5238) Summary: This gene encodes a member of the phosphohexose mutase family. The encoded protein mediates both glycogen formation and utilization by catalyzing the interconversion of glucose-1-phosphate and glucose-6-phosphate. A non-synonymous single nucleotide polymorphism in this gene may play a role in resistance to diabetic nephropathy and neuropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Mouse(109785) phosphoglucomutase 3
Rat(363109) phosphoglucomutase 3
domestic guinea pig(100729188) phosphoglucomutase 3
naked mole-rat(101717718) phosphoglucomutase 3
Domestic Rabbit(100340585) phosphoglucomutase 3
cow(505648) phosphoglucomutase 3
sheep(101115283) phosphoglucomutase 3
Zebrafish(474321) phosphoglucomutase 3
chicken(421841) phosphoglucomutase 3
Horse(100065388) phosphoglucomutase 3
domestic cat(101081633) phosphoglucomutase 3
dog(474981) phosphoglucomutase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015599 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015599 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015599 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028352 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028352 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028352 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030501 MISSION® esiRNA targeting human PGM3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015599 Rosetta Predictions human pricing
NM_001108772 Rosetta Predictions rat pricing
NM_028352 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144327 predicted 204
2 SASI_Hs01_00144328 predicted 491
3 SASI_Hs01_00144329 predicted 1742
4 SASI_Hs02_00348179 predicted 760
5 SASI_Hs01_00144330 predicted 1578
6 SASI_Hs01_00144331 predicted 554
7 SASI_Hs01_00144332 predicted 1531
8 SASI_Hs01_00144333 predicted 1417
9 SASI_Hs01_00144334 predicted 825
10 SASI_Hs01_00144335 predicted 980
11 SASI_Hs01_00144336 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108772 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241925 predicted 267
2 SASI_Rn02_00241926 predicted 1755
3 SASI_Rn02_00241927 predicted 817
4 SASI_Rn02_00241928 predicted 1483
5 SASI_Rn02_00241929 predicted 197
6 SASI_Rn02_00241930 predicted 1784
7 SASI_Rn02_00241931 predicted 479
8 SASI_Rn02_00241932 predicted 1769
9 SASI_Rn02_00241933 predicted 908
10 SASI_Rn02_00241934 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095824 predicted 620
2 SASI_Mm01_00095825 predicted 250
3 SASI_Mm01_00095826 predicted 197
4 SASI_Mm01_00095828 predicted 1052
5 SASI_Mm01_00095829 predicted 1350
6 SASI_Mm01_00095830 predicted 316
7 SASI_Mm01_00095831 predicted 1767
8 SASI_Mm02_00333725 predicted 1185
9 SASI_Mm01_00095832 predicted 604
10 SASI_Mm01_00095833 predicted 574
11 SASI_Mm01_00095827 predicted 1225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015599
VALIDATED
PGM3 MISSION shRNA Bacterial Glycerol Stock
phosphoglucomutase 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_015599.1-935s21c1
Sequence:CCGGGACAAGATAGCAACGTTAATTCTCGAGAATTAACGTTGCTATCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_015599.1-435s21c1
Sequence:CCGGGCAGTGAGAAACTTTCACAATCTCGAGATTGTGAAAGTTTCTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_015599.1-700s21c1
Sequence:CCGGGCTAAGGGAAATGGAACACTACTCGAGTAGTGTTCCATTTCCCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015599.1-843s1c2
Sequence:CCGGCCAATGAAAGATGCTGTTCTTCTCGAGAAGAACAGCATCTTTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015599.1-435s1c1
Sequence:CCGGGCAGTGAGAAACTTTCACAATCTCGAGATTGTGAAAGTTTCTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015599.1-1309s1c1
Sequence:CCGGGCTGGTGATTGAAGCAATCTTCTCGAGAAGATTGCTTCAATCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015599.1-700s1c1
Sequence:CCGGGCTAAGGGAAATGGAACACTACTCGAGTAGTGTTCCATTTCCCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_015599.1-1309s21c1
Sequence:CCGGGCTGGTGATTGAAGCAATCTTCTCGAGAAGATTGCTTCAATCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015599.1-1737s21c1
Sequence:CCGGGCAGTACTAAGAGATTTATAACTCGAGTTATAAATCTCTTAGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015599.1-86s1c1
Sequence:CCGGCCCAATGGACTGATCCTTCAACTCGAGTTGAAGGATCAGTCCATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015599
VALIDATED
PGM3 MISSION shRNA shRNA Plasmid DNA
phosphoglucomutase 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_015599.1-935s21c1
Sequence:CCGGGACAAGATAGCAACGTTAATTCTCGAGAATTAACGTTGCTATCTTGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000300585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_015599.1-435s21c1
Sequence:CCGGGCAGTGAGAAACTTTCACAATCTCGAGATTGTGAAAGTTTCTCACTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000300586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_015599.1-700s21c1
Sequence:CCGGGCTAAGGGAAATGGAACACTACTCGAGTAGTGTTCCATTTCCCTTAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000174095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015599.1-843s1c2
Sequence:CCGGCCAATGAAAGATGCTGTTCTTCTCGAGAAGAACAGCATCTTTCATTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000049053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015599.1-435s1c1
Sequence:CCGGGCAGTGAGAAACTTTCACAATCTCGAGATTGTGAAAGTTTCTCACTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000049055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015599.1-1309s1c1
Sequence:CCGGGCTGGTGATTGAAGCAATCTTCTCGAGAAGATTGCTTCAATCACCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000049057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015599.1-700s1c1
Sequence:CCGGGCTAAGGGAAATGGAACACTACTCGAGTAGTGTTCCATTTCCCTTAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000310637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_015599.1-1309s21c1
Sequence:CCGGGCTGGTGATTGAAGCAATCTTCTCGAGAAGATTGCTTCAATCACCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000304021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015599.1-1737s21c1
Sequence:CCGGGCAGTACTAAGAGATTTATAACTCGAGTTATAAATCTCTTAGTACTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000049056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015599.1-86s1c1
Sequence:CCGGCCCAATGGACTGATCCTTCAACTCGAGTTGAAGGATCAGTCCATTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015599
VALIDATED
PGM3 MISSION shRNA Lentiviral Transduction Particles
phosphoglucomutase 3
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000304020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_015599.1-935s21c1
Sequence:CCGGGACAAGATAGCAACGTTAATTCTCGAGAATTAACGTTGCTATCTTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_015599.1-435s21c1
Sequence:CCGGGCAGTGAGAAACTTTCACAATCTCGAGATTGTGAAAGTTTCTCACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_015599.1-700s21c1
Sequence:CCGGGCTAAGGGAAATGGAACACTACTCGAGTAGTGTTCCATTTCCCTTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015599.1-843s1c2
Sequence:CCGGCCAATGAAAGATGCTGTTCTTCTCGAGAAGAACAGCATCTTTCATTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015599.1-435s1c1
Sequence:CCGGGCAGTGAGAAACTTTCACAATCTCGAGATTGTGAAAGTTTCTCACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015599.1-1309s1c1
Sequence:CCGGGCTGGTGATTGAAGCAATCTTCTCGAGAAGATTGCTTCAATCACCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015599.1-700s1c1
Sequence:CCGGGCTAAGGGAAATGGAACACTACTCGAGTAGTGTTCCATTTCCCTTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_015599.1-1309s21c1
Sequence:CCGGGCTGGTGATTGAAGCAATCTTCTCGAGAAGATTGCTTCAATCACCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015599.1-1737s21c1
Sequence:CCGGGCAGTACTAAGAGATTTATAACTCGAGTTATAAATCTCTTAGTACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015599.1-86s1c1
Sequence:CCGGCCCAATGGACTGATCCTTCAACTCGAGTTGAAGGATCAGTCCATTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028352
VALIDATED
PGM3 MISSION shRNA Bacterial Glycerol Stock
phosphoglucomutase 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028352.2-1443s1c1
Sequence:CCGGCCTAACAGACAACTCAAAGTTCTCGAGAACTTTGAGTTGTCTGTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028352.2-2046s1c1
Sequence:CCGGCCCTTTCGATTGCTTACCTAACTCGAGTTAGGTAAGCAATCGAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028352.2-4070s1c1
Sequence:CCGGCCTAACTCTATGTACTGTTAACTCGAGTTAACAGTACATAGAGTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028352.2-1273s1c1
Sequence:CCGGCCCAAGAACTAGACGATGGAACTCGAGTTCCATCGTCTAGTTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028352.2-3534s1c1
Sequence:CCGGCCTTCCTGTTTACCTGTCATTCTCGAGAATGACAGGTAAACAGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028352.2-994s1c1
Sequence:CCGGGAGACAAGATAGCGACGTTAACTCGAGTTAACGTCGCTATCTTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028352
VALIDATED
PGM3 MISSION shRNA shRNA Plasmid DNA
phosphoglucomutase 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028352.2-1443s1c1
Sequence:CCGGCCTAACAGACAACTCAAAGTTCTCGAGAACTTTGAGTTGTCTGTTAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000198208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028352.2-2046s1c1
Sequence:CCGGCCCTTTCGATTGCTTACCTAACTCGAGTTAGGTAAGCAATCGAAAGGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000177608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028352.2-4070s1c1
Sequence:CCGGCCTAACTCTATGTACTGTTAACTCGAGTTAACAGTACATAGAGTTAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000182756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028352.2-1273s1c1
Sequence:CCGGCCCAAGAACTAGACGATGGAACTCGAGTTCCATCGTCTAGTTCTTGGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000198037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028352.2-3534s1c1
Sequence:CCGGCCTTCCTGTTTACCTGTCATTCTCGAGAATGACAGGTAAACAGGAAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000198307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028352.2-994s1c1
Sequence:CCGGGAGACAAGATAGCGACGTTAACTCGAGTTAACGTCGCTATCTTGTCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028352
VALIDATED
PGM3 MISSION shRNA Lentiviral Transduction Particles
phosphoglucomutase 3
Mouse
6 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000197457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028352.2-1443s1c1
Sequence:CCGGCCTAACAGACAACTCAAAGTTCTCGAGAACTTTGAGTTGTCTGTTAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028352.2-2046s1c1
Sequence:CCGGCCCTTTCGATTGCTTACCTAACTCGAGTTAGGTAAGCAATCGAAAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028352.2-4070s1c1
Sequence:CCGGCCTAACTCTATGTACTGTTAACTCGAGTTAACAGTACATAGAGTTAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028352.2-1273s1c1
Sequence:CCGGCCCAAGAACTAGACGATGGAACTCGAGTTCCATCGTCTAGTTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028352.2-3534s1c1
Sequence:CCGGCCTTCCTGTTTACCTGTCATTCTCGAGAATGACAGGTAAACAGGAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028352.2-994s1c1
Sequence:CCGGGAGACAAGATAGCGACGTTAACTCGAGTTAACGTCGCTATCTTGTCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)