EMAIL THIS PAGE TO A FRIEND

PGM5

phosphoglucomutase 5

117 Gene Product Result for
Synonyms: PGMRP
UniProtKB ID: Q15124, B1AM46, B4DLQ6, Q5VYV3, Q8N527, Q9UDH4
Gene ID:
Human(5239) Summary: Phosphoglucomutases (EC 5.2.2.2.), such as PGM5, are phosphotransferases involved in interconversion of glucose-1-phosphate and glucose-6-phosphate. PGM activity is essential in formation of carbohydrates from glucose-6-phosphate and in formation of glucose-6-phosphate from galactose and glycogen (Edwards et al., 1995 [PubMed 8586438]
Mouse(226041) phosphoglucomutase 5
Rat(679990) phosphoglucomutase 5
Zebrafish(560297) phosphoglucomutase 5
chicken(427215) phosphoglucomutase 5
domestic cat(101084397) phosphoglucomutase 5
dog(476332) phosphoglucomutase 5
cow(785045) phosphoglucomutase 5
sheep(101108630) phosphoglucomutase 5
naked mole-rat(101698296) phosphoglucomutase 5
domestic guinea pig(100723654) phosphoglucomutase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021965 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175013 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175013 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175013 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108291 MISSION® esiRNA esiRNA human PGM5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021965 Rosetta Predictions human pricing
XM_574644 Rosetta Predictions rat pricing
NM_175013 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031964 predicted 1490
2 SASI_Hs01_00031965 predicted 699
3 SASI_Hs01_00031966 predicted 1854
4 SASI_Hs01_00031967 predicted 917
5 SASI_Hs01_00031968 predicted 1280
6 SASI_Hs01_00031970 predicted 1480
7 SASI_Hs01_00031971 predicted 785
8 SASI_Hs01_00031973 predicted 738
9 SASI_Hs02_00355308 predicted 918
10 SASI_Hs02_00355309 predicted 1088
11 SASI_Hs01_00031969 predicted 972
12 SASI_Hs01_00031972 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402320 predicted 455
2 SASI_Rn02_00402321 predicted 949
3 SASI_Rn02_00402322 predicted 1623
4 SASI_Rn02_00402323 predicted 1319
5 SASI_Rn02_00402324 predicted 1225
6 SASI_Rn02_00402325 predicted 1384
7 SASI_Rn02_00402326 predicted 290
8 SASI_Rn02_00402327 predicted 922
9 SASI_Rn02_00402328 predicted 669
10 SASI_Rn02_00402329 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345579 predicted 1448
2 SASI_Mm02_00345580 predicted 937
3 SASI_Mm02_00345581 predicted 1208
4 SASI_Mm02_00345582 predicted 672
5 SASI_Mm02_00345583 predicted 362
6 SASI_Mm02_00345584 predicted 275
7 SASI_Mm02_00345585 predicted 808
8 SASI_Mm02_00345586 predicted 541
9 SASI_Mm02_00345587 predicted 716
10 SASI_Mm02_00345588 predicted 1469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021965
PGM5 MISSION shRNA Bacterial Glycerol Stock
phosphoglucomutase 5
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021965.2-1508s1c1
Sequence:CCGGCGCCACTACTATTGCAGGTTTCTCGAGAAACCTGCAATAGTAGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021965.2-1585s1c1
Sequence:CCGGCCTGGTCACAGACAAATCCTTCTCGAGAAGGATTTGTCTGTGACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021965.2-1277s1c1
Sequence:CCGGGCCAAATCAATGAAGGTCCCTCTCGAGAGGGACCTTCATTGATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021965.2-1645s1c1
Sequence:CCGGCGTGGCGAAGACGGATAGTTTCTCGAGAAACTATCCGTCTTCGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021965.2-497s1c1
Sequence:CCGGCGACTGATTATTGGACAGAATCTCGAGATTCTGTCCAATAATCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021965.3-1483s21c1
Sequence:CCGGCCGAGATCACTGGGCCAAATTCTCGAGAATTTGGCCCAGTGATCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021965
PGM5 MISSION shRNA shRNA Plasmid DNA
phosphoglucomutase 5
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021965.2-1508s1c1
Sequence:CCGGCGCCACTACTATTGCAGGTTTCTCGAGAAACCTGCAATAGTAGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021965.2-1585s1c1
Sequence:CCGGCCTGGTCACAGACAAATCCTTCTCGAGAAGGATTTGTCTGTGACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021965.2-1277s1c1
Sequence:CCGGGCCAAATCAATGAAGGTCCCTCTCGAGAGGGACCTTCATTGATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021965.2-1645s1c1
Sequence:CCGGCGTGGCGAAGACGGATAGTTTCTCGAGAAACTATCCGTCTTCGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021965.2-497s1c1
Sequence:CCGGCGACTGATTATTGGACAGAATCTCGAGATTCTGTCCAATAATCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000455014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021965.3-1483s21c1
Sequence:CCGGCCGAGATCACTGGGCCAAATTCTCGAGAATTTGGCCCAGTGATCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021965
PGM5 MISSION shRNA Lentiviral Transduction Particles
phosphoglucomutase 5
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021965.2-1508s1c1
Sequence:CCGGCGCCACTACTATTGCAGGTTTCTCGAGAAACCTGCAATAGTAGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021965.2-1585s1c1
Sequence:CCGGCCTGGTCACAGACAAATCCTTCTCGAGAAGGATTTGTCTGTGACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021965.2-1277s1c1
Sequence:CCGGGCCAAATCAATGAAGGTCCCTCTCGAGAGGGACCTTCATTGATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021965.2-1645s1c1
Sequence:CCGGCGTGGCGAAGACGGATAGTTTCTCGAGAAACTATCCGTCTTCGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021965.2-497s1c1
Sequence:CCGGCGACTGATTATTGGACAGAATCTCGAGATTCTGTCCAATAATCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021965.3-1483s21c1
Sequence:CCGGCCGAGATCACTGGGCCAAATTCTCGAGAATTTGGCCCAGTGATCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175013
PGM5 MISSION shRNA Bacterial Glycerol Stock
phosphoglucomutase 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175013.1-299s1c1
Sequence:CCGGGTGAAGTTTAATGTTGCCAATCTCGAGATTGGCAACATTAAACTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175013.1-154s1c1
Sequence:CCGGCAATGGGATTGGTCGACTGATCTCGAGATCAGTCGACCAATCCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175013.1-416s1c1
Sequence:CCGGCAACTGAAGATCCGTGTTGATCTCGAGATCAACACGGATCTTCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175013.1-509s1c1
Sequence:CCGGGCAATAAACTGTGTCCCACTACTCGAGTAGTGGGACACAGTTTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175013.2-1088s21c1
Sequence:CCGGTCTGGACAGAGTGGCTAAATCCTCGAGGATTTAGCCACTCTGTCCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175013.2-1551s21c1
Sequence:CCGGTCGGATGCATCACGGCTAATACTCGAGTATTAGCCGTGATGCATCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175013.2-1254s21c1
Sequence:CCGGTTGGTCTGGCTGTCCATTATTCTCGAGAATAATGGACAGCCAGACCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175013.2-166s21c1
Sequence:CCGGGCAACTACCTGCCCAACTTCACTCGAGTGAAGTTGGGCAGGTAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175013.2-654s21c1
Sequence:CCGGCTCAACCTCCTCCGGAATATCCTCGAGGATATTCCGGAGGAGGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175013
PGM5 MISSION shRNA shRNA Plasmid DNA
phosphoglucomutase 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175013.1-299s1c1
Sequence:CCGGGTGAAGTTTAATGTTGCCAATCTCGAGATTGGCAACATTAAACTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175013.1-154s1c1
Sequence:CCGGCAATGGGATTGGTCGACTGATCTCGAGATCAGTCGACCAATCCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175013.1-416s1c1
Sequence:CCGGCAACTGAAGATCCGTGTTGATCTCGAGATCAACACGGATCTTCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175013.1-509s1c1
Sequence:CCGGGCAATAAACTGTGTCCCACTACTCGAGTAGTGGGACACAGTTTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175013.2-1088s21c1
Sequence:CCGGTCTGGACAGAGTGGCTAAATCCTCGAGGATTTAGCCACTCTGTCCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175013.2-1551s21c1
Sequence:CCGGTCGGATGCATCACGGCTAATACTCGAGTATTAGCCGTGATGCATCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175013.2-1254s21c1
Sequence:CCGGTTGGTCTGGCTGTCCATTATTCTCGAGAATAATGGACAGCCAGACCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175013.2-166s21c1
Sequence:CCGGGCAACTACCTGCCCAACTTCACTCGAGTGAAGTTGGGCAGGTAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175013.2-654s21c1
Sequence:CCGGCTCAACCTCCTCCGGAATATCCTCGAGGATATTCCGGAGGAGGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175013
PGM5 MISSION shRNA Lentiviral Transduction Particles
phosphoglucomutase 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175013.1-299s1c1
Sequence:CCGGGTGAAGTTTAATGTTGCCAATCTCGAGATTGGCAACATTAAACTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175013.1-154s1c1
Sequence:CCGGCAATGGGATTGGTCGACTGATCTCGAGATCAGTCGACCAATCCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175013.1-416s1c1
Sequence:CCGGCAACTGAAGATCCGTGTTGATCTCGAGATCAACACGGATCTTCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175013.1-509s1c1
Sequence:CCGGGCAATAAACTGTGTCCCACTACTCGAGTAGTGGGACACAGTTTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175013.2-1088s21c1
Sequence:CCGGTCTGGACAGAGTGGCTAAATCCTCGAGGATTTAGCCACTCTGTCCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175013.2-1551s21c1
Sequence:CCGGTCGGATGCATCACGGCTAATACTCGAGTATTAGCCGTGATGCATCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175013.2-1254s21c1
Sequence:CCGGTTGGTCTGGCTGTCCATTATTCTCGAGAATAATGGACAGCCAGACCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175013.2-166s21c1
Sequence:CCGGGCAACTACCTGCCCAACTTCACTCGAGTGAAGTTGGGCAGGTAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175013.2-654s21c1
Sequence:CCGGCTCAACCTCCTCCGGAATATCCTCGAGGATATTCCGGAGGAGGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)