EMAIL THIS PAGE TO A FRIEND

PGM5P1

phosphoglucomutase 5 pseudogene 1

20 Gene Product Result for
Species: Human PGM5P1(653394)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372112 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_372112 Rosetta Predictions human pricing
XM_933079 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298514 predicted 1076
2 SASI_Hs01_00298515 predicted 1296
3 SASI_Hs01_00298516 predicted 1132
4 SASI_Hs01_00298517 predicted 1036
5 SASI_Hs01_00298518 predicted 1344
6 SASI_Hs01_00298519 predicted 1103
7 SASI_Hs01_00298520 predicted 1073
8 SASI_Hs01_00298521 predicted 1291
9 SASI_Hs01_00298522 predicted 1455
10 SASI_Hs01_00298523 predicted 1169
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273983 predicted 1076
2 SASI_Hs01_00273984 predicted 1295
3 SASI_Hs01_00273985 predicted 1124
4 SASI_Hs01_00273986 predicted 1035
5 SASI_Hs01_00273987 predicted 1341
6 SASI_Hs01_00273988 predicted 1109
7 SASI_Hs01_00273989 predicted 1072
8 SASI_Hs01_00273990 predicted 1291
9 SASI_Hs01_00273991 predicted 1460
10 SASI_Hs01_00273992 predicted 1171
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372112
PGM5P1 MISSION shRNA Bacterial Glycerol Stock
phosphoglucomutase 5 pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372112.2-1269s1c1
Sequence:CCGGACAGAGAGACATCTGGTGATACTCGAGTATCACCAGATGTCTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372112.2-1278s1c1
Sequence:CCGGCATCTGGTGATACTATCTGTTCTCGAGAACAGATAGTATCACCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372112.2-1192s1c1
Sequence:CCGGCCTCTCTTGCATTCCATATTTCTCGAGAAATATGGAATGCAAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372112.2-1028s1c1
Sequence:CCGGCCTGACCCAAACCTGACATATCTCGAGATATGTCAGGTTTGGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372112.2-973s1c1
Sequence:CCGGCCCAGCCAATTCTGCAATAAACTCGAGTTTATTGCAGAATTGGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372112
PGM5P1 MISSION shRNA shRNA Plasmid DNA
phosphoglucomutase 5 pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372112.2-1269s1c1
Sequence:CCGGACAGAGAGACATCTGGTGATACTCGAGTATCACCAGATGTCTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372112.2-1278s1c1
Sequence:CCGGCATCTGGTGATACTATCTGTTCTCGAGAACAGATAGTATCACCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372112.2-1192s1c1
Sequence:CCGGCCTCTCTTGCATTCCATATTTCTCGAGAAATATGGAATGCAAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372112.2-1028s1c1
Sequence:CCGGCCTGACCCAAACCTGACATATCTCGAGATATGTCAGGTTTGGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372112.2-973s1c1
Sequence:CCGGCCCAGCCAATTCTGCAATAAACTCGAGTTTATTGCAGAATTGGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372112
PGM5P1 MISSION shRNA Lentiviral Transduction Particles
phosphoglucomutase 5 pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372112.2-1269s1c1
Sequence:CCGGACAGAGAGACATCTGGTGATACTCGAGTATCACCAGATGTCTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372112.2-1278s1c1
Sequence:CCGGCATCTGGTGATACTATCTGTTCTCGAGAACAGATAGTATCACCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372112.2-1192s1c1
Sequence:CCGGCCTCTCTTGCATTCCATATTTCTCGAGAAATATGGAATGCAAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372112.2-1028s1c1
Sequence:CCGGCCTGACCCAAACCTGACATATCTCGAGATATGTCAGGTTTGGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372112.2-973s1c1
Sequence:CCGGCCCAGCCAATTCTGCAATAAACTCGAGTTTATTGCAGAATTGGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)