EMAIL THIS PAGE TO A FRIEND

PGP

phosphoglycolate phosphatase

52 Gene Product Result for
UniProtKB ID: A6NDG6
Gene ID:
Mouse(67078) phosphoglycolate phosphatase
Rat(287115) phosphoglycolate phosphatase
Zebrafish(792824) phosphoglycolate phosphatase
chicken(416559) phosphoglycolate phosphatase
dog(610926) phosphoglycolate phosphatase
domestic cat(101081514) phosphoglycolate phosphatase
domestic guinea pig(100733734) phosphoglycolate phosphatase
naked mole-rat(101711561) phosphoglycolate phosphatase
cow(538173) phosphoglycolate phosphatase
sheep(101115175) phosphoglycolate phosphatase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_208887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_208887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_208887 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025954 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025954 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025954 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001042371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042371 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042371 Rosetta Predictions human pricing
XM_001055264 Rosetta Predictions rat pricing
XM_213235 Rosetta Predictions rat pricing
NM_025954 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309348 predicted 1272
2 SASI_Hs02_00309349 predicted 1399
3 SASI_Hs02_00309350 predicted 1111
4 SASI_Hs02_00309351 predicted 921
5 SASI_Hs02_00309352 predicted 1090
6 SASI_Hs02_00309353 predicted 1125
7 SASI_Hs02_00309354 predicted 1447
8 SASI_Hs02_00309355 predicted 640
9 SASI_Hs02_00309356 predicted 653
10 SASI_Hs02_00309357 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055264 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279026 predicted 1660
2 SASI_Rn02_00279027 predicted 1666
3 SASI_Rn02_00279028 predicted 1712
4 SASI_Rn02_00279029 predicted 634
5 SASI_Rn02_00279030 predicted 628
6 SASI_Rn02_00279031 predicted 1772
7 SASI_Rn02_00279032 predicted 1016
8 SASI_Rn02_00279033 predicted 925
9 SASI_Rn02_00279034 predicted 1148
10 SASI_Rn02_00279035 predicted 1636
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374449 predicted 1659
2 SASI_Rn02_00374450 predicted 1669
3 SASI_Rn02_00374451 predicted 1709
4 SASI_Rn02_00374452 predicted 639
5 SASI_Rn02_00374453 predicted 625
6 SASI_Rn02_00374454 predicted 1772
7 SASI_Rn02_00374455 predicted 1022
8 SASI_Rn02_00374456 predicted 923
9 SASI_Rn02_00374457 predicted 1155
10 SASI_Rn02_00374458 predicted 1636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130387 predicted 324
2 SASI_Mm01_00130388 predicted 649
3 SASI_Mm01_00130389 predicted 780
4 SASI_Mm01_00130390 predicted 338
5 SASI_Mm01_00130391 predicted 557
6 SASI_Mm01_00130393 predicted 568
7 SASI_Mm01_00130394 predicted 244
8 SASI_Mm02_00329355 predicted 635
9 SASI_Mm01_00130395 predicted 325
10 SASI_Mm01_00130396 predicted 495
11 SASI_Mm01_00130392 predicted 616
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_208887
PGP MISSION shRNA Bacterial Glycerol Stock
phosphoglycolate phosphatase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208887.5-527s1c1
Sequence:CCGGCCCGCACTTCAGCTACATGAACTCGAGTTCATGTAGCTGAAGTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208887.5-740s1c1
Sequence:CCGGGTCCCAGGAATACGGCATCAACTCGAGTTGATGCCGTATTCCTGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208887.5-611s1c1
Sequence:CCGGCAACCGGCTTCCGCTTGAGAACTCGAGTTCTCAAGCGGAAGCCGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208887.5-731s1c1
Sequence:CCGGCGACTGCGTGTCCCAGGAATACTCGAGTATTCCTGGGACACGCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208887.5-692s1c1
Sequence:CCGGCCAGGCCGACATCATCGGGAACTCGAGTTCCCGATGATGTCGGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_208887
PGP MISSION shRNA shRNA Plasmid DNA
phosphoglycolate phosphatase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208887.5-527s1c1
Sequence:CCGGCCCGCACTTCAGCTACATGAACTCGAGTTCATGTAGCTGAAGTGCGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000082721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208887.5-740s1c1
Sequence:CCGGGTCCCAGGAATACGGCATCAACTCGAGTTGATGCCGTATTCCTGGGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000082720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208887.5-611s1c1
Sequence:CCGGCAACCGGCTTCCGCTTGAGAACTCGAGTTCTCAAGCGGAAGCCGGTTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000082719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208887.5-731s1c1
Sequence:CCGGCGACTGCGTGTCCCAGGAATACTCGAGTATTCCTGGGACACGCAGTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000082722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208887.5-692s1c1
Sequence:CCGGCCAGGCCGACATCATCGGGAACTCGAGTTCCCGATGATGTCGGCCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_208887
PGP MISSION shRNA Lentiviral Transduction Particles
phosphoglycolate phosphatase
Human
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000082718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208887.5-527s1c1
Sequence:CCGGCCCGCACTTCAGCTACATGAACTCGAGTTCATGTAGCTGAAGTGCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208887.5-740s1c1
Sequence:CCGGGTCCCAGGAATACGGCATCAACTCGAGTTGATGCCGTATTCCTGGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208887.5-611s1c1
Sequence:CCGGCAACCGGCTTCCGCTTGAGAACTCGAGTTCTCAAGCGGAAGCCGGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208887.5-731s1c1
Sequence:CCGGCGACTGCGTGTCCCAGGAATACTCGAGTATTCCTGGGACACGCAGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208887.5-692s1c1
Sequence:CCGGCCAGGCCGACATCATCGGGAACTCGAGTTCCCGATGATGTCGGCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025954
VALIDATED
PGP MISSION shRNA Bacterial Glycerol Stock
phosphoglycolate phosphatase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025954.2-622s1c1
Sequence:CCGGCGTGGGCACCAACATGGACAACTCGAGTTGTCCATGTTGGTGCCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025954.2-726s1c1
Sequence:CCGGCGGACATCATCGGGAAGCCTACTCGAGTAGGCTTCCCGATGATGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025954.2-556s1c1
Sequence:CCGGCCCACACTTCAGCTACATGAACTCGAGTTCATGTAGCTGAAGTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025954.2-850s1c1
Sequence:CCGGCTGTAGCCTGAAGACTATCCTCTCGAGAGGATAGTCTTCAGGCTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025954.2-125s1c1
Sequence:CCGGACGCTGCTGTTCGACTGCGATCTCGAGATCGCAGTCGAACAGCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025954.3-850s21c1
Sequence:CCGGCTGTAGCCTGAAGACTATCCTCTCGAGAGGATAGTCTTCAGGCTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025954.3-125s21c1
Sequence:CCGGACGCTGCTGTTCGACTGCGATCTCGAGATCGCAGTCGAACAGCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025954.3-767s21c1
Sequence:CCGGGTGTCCCAGGAGTATGGTATCCTCGAGGATACCATACTCCTGGGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025954.3-556s21c1
Sequence:CCGGCCCACACTTCAGCTACATGAACTCGAGTTCATGTAGCTGAAGTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025954
VALIDATED
PGP MISSION shRNA shRNA Plasmid DNA
phosphoglycolate phosphatase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025954.2-622s1c1
Sequence:CCGGCGTGGGCACCAACATGGACAACTCGAGTTGTCCATGTTGGTGCCCACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000081474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025954.2-726s1c1
Sequence:CCGGCGGACATCATCGGGAAGCCTACTCGAGTAGGCTTCCCGATGATGTCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000081475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025954.2-556s1c1
Sequence:CCGGCCCACACTTCAGCTACATGAACTCGAGTTCATGTAGCTGAAGTGTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000081477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025954.2-850s1c1
Sequence:CCGGCTGTAGCCTGAAGACTATCCTCTCGAGAGGATAGTCTTCAGGCTACAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000081476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025954.2-125s1c1
Sequence:CCGGACGCTGCTGTTCGACTGCGATCTCGAGATCGCAGTCGAACAGCAGCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000349140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025954.3-850s21c1
Sequence:CCGGCTGTAGCCTGAAGACTATCCTCTCGAGAGGATAGTCTTCAGGCTACAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000315968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025954.3-125s21c1
Sequence:CCGGACGCTGCTGTTCGACTGCGATCTCGAGATCGCAGTCGAACAGCAGCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000379306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025954.3-767s21c1
Sequence:CCGGGTGTCCCAGGAGTATGGTATCCTCGAGGATACCATACTCCTGGGACACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000349141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025954.3-556s21c1
Sequence:CCGGCCCACACTTCAGCTACATGAACTCGAGTTCATGTAGCTGAAGTGTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025954
VALIDATED
PGP MISSION shRNA Lentiviral Transduction Particles
phosphoglycolate phosphatase
Mouse
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000081473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025954.2-622s1c1
Sequence:CCGGCGTGGGCACCAACATGGACAACTCGAGTTGTCCATGTTGGTGCCCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025954.2-726s1c1
Sequence:CCGGCGGACATCATCGGGAAGCCTACTCGAGTAGGCTTCCCGATGATGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025954.2-556s1c1
Sequence:CCGGCCCACACTTCAGCTACATGAACTCGAGTTCATGTAGCTGAAGTGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025954.2-850s1c1
Sequence:CCGGCTGTAGCCTGAAGACTATCCTCTCGAGAGGATAGTCTTCAGGCTACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025954.2-125s1c1
Sequence:CCGGACGCTGCTGTTCGACTGCGATCTCGAGATCGCAGTCGAACAGCAGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025954.3-850s21c1
Sequence:CCGGCTGTAGCCTGAAGACTATCCTCTCGAGAGGATAGTCTTCAGGCTACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025954.3-125s21c1
Sequence:CCGGACGCTGCTGTTCGACTGCGATCTCGAGATCGCAGTCGAACAGCAGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025954.3-767s21c1
Sequence:CCGGGTGTCCCAGGAGTATGGTATCCTCGAGGATACCATACTCCTGGGACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025954.3-556s21c1
Sequence:CCGGCCCACACTTCAGCTACATGAACTCGAGTTCATGTAGCTGAAGTGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042371
PGP MISSION shRNA Bacterial Glycerol Stock
phosphoglycolate phosphatase
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000360284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042371.2-924s21c1
Sequence:CCGGGAAAGTGACTGCGTGTCTAAGCTCGAGCTTAGACACGCAGTCACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042371.2-991s21c1
Sequence:CCGGTGCCTGCCCTTCAAGGTTAAACTCGAGTTTAACCTTGAAGGGCAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042371.2-1133s21c1
Sequence:CCGGAGCAAAGGCATTCATTGTTAACTCGAGTTAACAATGAATGCCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042371
PGP MISSION shRNA shRNA Plasmid DNA
phosphoglycolate phosphatase
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000360284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042371.2-924s21c1
Sequence:CCGGGAAAGTGACTGCGTGTCTAAGCTCGAGCTTAGACACGCAGTCACTTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000360282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042371.2-991s21c1
Sequence:CCGGTGCCTGCCCTTCAAGGTTAAACTCGAGTTTAACCTTGAAGGGCAGGCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000360283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042371.2-1133s21c1
Sequence:CCGGAGCAAAGGCATTCATTGTTAACTCGAGTTAACAATGAATGCCTTTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042371
PGP MISSION shRNA Lentiviral Transduction Particles
phosphoglycolate phosphatase
Human
3 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (3)? Select
TRCN0000360284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042371.2-924s21c1
Sequence:CCGGGAAAGTGACTGCGTGTCTAAGCTCGAGCTTAGACACGCAGTCACTTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042371.2-991s21c1
Sequence:CCGGTGCCTGCCCTTCAAGGTTAAACTCGAGTTTAACCTTGAAGGGCAGGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042371.2-1133s21c1
Sequence:CCGGAGCAAAGGCATTCATTGTTAACTCGAGTTAACAATGAATGCCTTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)