EMAIL THIS PAGE TO A FRIEND

PGPEP1

pyroglutamyl-peptidase I

65 Gene Product Result for
Synonyms: PGP PGP-I PGPI Pcp
UniProtKB ID: Q9NXJ5, A8K1Q3
Gene ID:
Human(54858) Summary: Pyroglutamyl peptidase I (EC 3.4.19.3) catalyzes the hydrolysis of N-terminal pyroglutamyl residues from oligopeptides and proteins.[supplied by OMIM, Mar 2008]
Mouse(66522) pyroglutamyl-peptidase I
Rat(290648) pyroglutamyl-peptidase I
Zebrafish(553547) pyroglutamyl-peptidase I
chicken(420127) pyroglutamyl-peptidase I
domestic cat(101094575) pyroglutamyl-peptidase I
dog(484823) pyroglutamyl-peptidase I
cow(615089) pyroglutamyl-peptidase I
sheep(101110234) pyroglutamyl-peptidase I
naked mole-rat(101721866) pyroglutamyl-peptidase I
domestic guinea pig(100716973) pyroglutamyl-peptidase I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023217 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023217 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023217 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017712 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017712 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017712 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017712 Rosetta Predictions human pricing
NM_201988 Rosetta Predictions rat pricing
NM_023217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219482 predicted 515
2 SASI_Hs01_00219483 predicted 424
3 SASI_Hs01_00219484 predicted 529
4 SASI_Hs01_00219485 predicted 630
5 SASI_Hs01_00219486 predicted 204
6 SASI_Hs01_00219487 predicted 640
7 SASI_Hs01_00219488 predicted 472
8 SASI_Hs01_00219490 predicted 531
9 SASI_Hs01_00219491 predicted 216
10 SASI_Hs02_00350476 predicted 229
11 SASI_Hs01_00219489 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086798 predicted 280
2 SASI_Rn01_00086799 predicted 690
3 SASI_Rn01_00086800 predicted 564
4 SASI_Rn01_00086802 predicted 286
5 SASI_Rn01_00086803 predicted 377
6 SASI_Rn01_00086804 predicted 286
7 SASI_Rn01_00086805 predicted 694
8 SASI_Rn02_00270341 predicted 454
9 SASI_Rn01_00086806 predicted 275
10 SASI_Rn02_00270342 predicted 685
11 SASI_Rn01_00086801 predicted 646
12 SASI_Rn01_00086807 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060524 predicted 300
2 SASI_Mm01_00060525 predicted 375
3 SASI_Mm01_00060527 predicted 395
4 SASI_Mm01_00060528 predicted 478
5 SASI_Mm02_00326972 predicted 1136
6 SASI_Mm01_00060529 predicted 1096
7 SASI_Mm01_00060530 predicted 1071
8 SASI_Mm01_00060531 predicted 866
9 SASI_Mm01_00060532 predicted 919
10 SASI_Mm01_00060533 predicted 475
11 SASI_Mm01_00060526 predicted 311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023217
VALIDATED
PGPEP1 MISSION shRNA Bacterial Glycerol Stock
pyroglutamyl-peptidase I
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023217.3-463s21c1
Sequence:CCGGAGGATGCTGGCAGGTATCTGTCTCGAGACAGATACCTGCCAGCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023217.3-158s21c1
Sequence:CCGGGGACCTGCATGTGTACGAGATCTCGAGATCTCGTACACATGCAGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023217.3-440s21c1
Sequence:CCGGGGACGTGTCTGTTACCATCTCCTCGAGGAGATGGTAACAGACACGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023217.3-299s21c1
Sequence:CCGGTGGGCACAACAAGGGTTACAACTCGAGTTGTAACCCTTGTTGTGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023217.3-906s21c1
Sequence:CCGGGGGCCTCACAAAGTATCATAACTCGAGTTATGATACTTTGTGAGGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023217.3-934s21c1
Sequence:CCGGTAGCTCTAATCCATGTCTTAACTCGAGTTAAGACATGGATTAGAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023217.3-660s21c1
Sequence:CCGGCAGCTCTGACAGCCATGTACACTCGAGTGTACATGGCTGTCAGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023217.2-492s1c1
Sequence:CCGGCACGTATTATACATCGCTCTACTCGAGTAGAGCGATGTATAATACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023217.2-594s1c1
Sequence:CCGGACGAGCTATCATCGAGGAGATCTCGAGATCTCCTCGATGATAGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023217.2-549s1c1
Sequence:CCGGCCCACTGGGTAAGCCCTACAACTCGAGTTGTAGGGCTTACCCAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023217.2-311s1c1
Sequence:CCGGAGGGTTACAAAGGACTGGATACTCGAGTATCCAGTCCTTTGTAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023217.2-300s1c1
Sequence:CCGGTGGGCACAACAAGGGTTACAACTCGAGTTGTAACCCTTGTTGTGCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023217
VALIDATED
PGPEP1 MISSION shRNA shRNA Plasmid DNA
pyroglutamyl-peptidase I
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023217.3-463s21c1
Sequence:CCGGAGGATGCTGGCAGGTATCTGTCTCGAGACAGATACCTGCCAGCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023217.3-158s21c1
Sequence:CCGGGGACCTGCATGTGTACGAGATCTCGAGATCTCGTACACATGCAGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023217.3-440s21c1
Sequence:CCGGGGACGTGTCTGTTACCATCTCCTCGAGGAGATGGTAACAGACACGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023217.3-299s21c1
Sequence:CCGGTGGGCACAACAAGGGTTACAACTCGAGTTGTAACCCTTGTTGTGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023217.3-906s21c1
Sequence:CCGGGGGCCTCACAAAGTATCATAACTCGAGTTATGATACTTTGTGAGGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023217.3-934s21c1
Sequence:CCGGTAGCTCTAATCCATGTCTTAACTCGAGTTAAGACATGGATTAGAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023217.3-660s21c1
Sequence:CCGGCAGCTCTGACAGCCATGTACACTCGAGTGTACATGGCTGTCAGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023217.2-492s1c1
Sequence:CCGGCACGTATTATACATCGCTCTACTCGAGTAGAGCGATGTATAATACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023217.2-594s1c1
Sequence:CCGGACGAGCTATCATCGAGGAGATCTCGAGATCTCCTCGATGATAGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023217.2-549s1c1
Sequence:CCGGCCCACTGGGTAAGCCCTACAACTCGAGTTGTAGGGCTTACCCAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023217.2-311s1c1
Sequence:CCGGAGGGTTACAAAGGACTGGATACTCGAGTATCCAGTCCTTTGTAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023217.2-300s1c1
Sequence:CCGGTGGGCACAACAAGGGTTACAACTCGAGTTGTAACCCTTGTTGTGCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023217
VALIDATED
PGPEP1 MISSION shRNA Lentiviral Transduction Particles
pyroglutamyl-peptidase I
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023217.3-463s21c1
Sequence:CCGGAGGATGCTGGCAGGTATCTGTCTCGAGACAGATACCTGCCAGCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023217.3-158s21c1
Sequence:CCGGGGACCTGCATGTGTACGAGATCTCGAGATCTCGTACACATGCAGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023217.3-440s21c1
Sequence:CCGGGGACGTGTCTGTTACCATCTCCTCGAGGAGATGGTAACAGACACGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023217.3-299s21c1
Sequence:CCGGTGGGCACAACAAGGGTTACAACTCGAGTTGTAACCCTTGTTGTGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023217.3-906s21c1
Sequence:CCGGGGGCCTCACAAAGTATCATAACTCGAGTTATGATACTTTGTGAGGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023217.3-934s21c1
Sequence:CCGGTAGCTCTAATCCATGTCTTAACTCGAGTTAAGACATGGATTAGAGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023217.3-660s21c1
Sequence:CCGGCAGCTCTGACAGCCATGTACACTCGAGTGTACATGGCTGTCAGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023217.2-492s1c1
Sequence:CCGGCACGTATTATACATCGCTCTACTCGAGTAGAGCGATGTATAATACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023217.2-594s1c1
Sequence:CCGGACGAGCTATCATCGAGGAGATCTCGAGATCTCCTCGATGATAGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023217.2-549s1c1
Sequence:CCGGCCCACTGGGTAAGCCCTACAACTCGAGTTGTAGGGCTTACCCAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023217.2-311s1c1
Sequence:CCGGAGGGTTACAAAGGACTGGATACTCGAGTATCCAGTCCTTTGTAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023217.2-300s1c1
Sequence:CCGGTGGGCACAACAAGGGTTACAACTCGAGTTGTAACCCTTGTTGTGCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017712
PGPEP1 MISSION shRNA Bacterial Glycerol Stock
pyroglutamyl-peptidase I
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017712.1-281s1c1
Sequence:CCGGCCACAGTCACACTGGAGAAATCTCGAGATTTCTCCAGTGTGACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017712.1-163s1c1
Sequence:CCGGGACCTGCATGTGTACGAGATTCTCGAGAATCTCGTACACATGCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017712.1-378s1c1
Sequence:CCGGGCCTGAAAGCATTGACTCCATCTCGAGATGGAGTCAATGCTTTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017712.1-476s1c1
Sequence:CCGGGCAGATATCTCTGCGACTTTACTCGAGTAAAGTCGCAGAGATATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017712.1-492s1c1
Sequence:CCGGCTTTACCTACTACACCTCTTTCTCGAGAAAGAGGTGTAGTAGGTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017712
PGPEP1 MISSION shRNA shRNA Plasmid DNA
pyroglutamyl-peptidase I
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017712.1-281s1c1
Sequence:CCGGCCACAGTCACACTGGAGAAATCTCGAGATTTCTCCAGTGTGACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017712.1-163s1c1
Sequence:CCGGGACCTGCATGTGTACGAGATTCTCGAGAATCTCGTACACATGCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017712.1-378s1c1
Sequence:CCGGGCCTGAAAGCATTGACTCCATCTCGAGATGGAGTCAATGCTTTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017712.1-476s1c1
Sequence:CCGGGCAGATATCTCTGCGACTTTACTCGAGTAAAGTCGCAGAGATATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017712.1-492s1c1
Sequence:CCGGCTTTACCTACTACACCTCTTTCTCGAGAAAGAGGTGTAGTAGGTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017712
PGPEP1 MISSION shRNA Lentiviral Transduction Particles
pyroglutamyl-peptidase I
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017712.1-281s1c1
Sequence:CCGGCCACAGTCACACTGGAGAAATCTCGAGATTTCTCCAGTGTGACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017712.1-163s1c1
Sequence:CCGGGACCTGCATGTGTACGAGATTCTCGAGAATCTCGTACACATGCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017712.1-378s1c1
Sequence:CCGGGCCTGAAAGCATTGACTCCATCTCGAGATGGAGTCAATGCTTTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017712.1-476s1c1
Sequence:CCGGGCAGATATCTCTGCGACTTTACTCGAGTAAAGTCGCAGAGATATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017712.1-492s1c1
Sequence:CCGGCTTTACCTACTACACCTCTTTCTCGAGAAAGAGGTGTAGTAGGTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)