EMAIL THIS PAGE TO A FRIEND

PGPEP1L

pyroglutamyl-peptidase I-like

58 Gene Product Result for
UniProtKB ID: A6NFU8
Gene ID:
Mouse(78444) pyroglutamyl-peptidase I-like
naked mole-rat(101722218) pyroglutamyl-peptidase I-like
cow(617726) pyroglutamyl-peptidase I-like
sheep(101111665) pyroglutamyl-peptidase I-like
Zebrafish(558733) pyroglutamyl-peptidase I-like
chicken(427509) pyroglutamyl-peptidase I-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_133560 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_133560 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_133560 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030101 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030101 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030101 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001102612 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001102612 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001102612 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU085951 MISSION® esiRNA esiRNA targeting mouse C330024D12Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102612 Rosetta Predictions human pricing
XM_372592 Rosetta Predictions human pricing
XM_927974 Rosetta Predictions human pricing
XM_133560 Rosetta Predictions mouse pricing
XM_978288 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323419 predicted 575
2 SASI_Hs02_00323420 predicted 566
3 SASI_Hs02_00323421 predicted 585
4 SASI_Hs02_00323422 predicted 736
5 SASI_Hs02_00323423 predicted 767
6 SASI_Hs02_00323424 predicted 503
7 SASI_Hs02_00323425 predicted 573
8 SASI_Hs02_00323426 predicted 553
9 SASI_Hs02_00323427 predicted 734
10 SASI_Hs02_00323428 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253927 predicted 1011
2 SASI_Hs01_00253928 predicted 1017
3 SASI_Hs01_00253929 predicted 1125
4 SASI_Hs01_00253930 predicted 1177
5 SASI_Hs01_00253931 predicted 1030
6 SASI_Hs01_00253932 predicted 1206
7 SASI_Hs01_00253933 predicted 941
8 SASI_Hs01_00253934 predicted 816
9 SASI_Hs01_00253935 predicted 1029
10 SASI_Hs01_00253936 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288441 predicted 564
2 SASI_Hs01_00288442 predicted 584
3 SASI_Hs01_00288443 predicted 734
4 SASI_Hs01_00288444 predicted 584
5 SASI_Hs01_00288445 predicted 500
6 SASI_Hs01_00288446 predicted 592
7 SASI_Hs01_00288447 predicted 572
8 SASI_Hs01_00288448 predicted 555
9 SASI_Hs01_00288449 predicted 732
10 SASI_Hs01_00288450 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247638 predicted 276
2 SASI_Mm01_00247639 predicted 254
3 SASI_Mm01_00247640 predicted 447
4 SASI_Mm01_00247641 predicted 357
5 SASI_Mm01_00247642 predicted 356
6 SASI_Mm01_00247643 predicted 281
7 SASI_Mm01_00247644 predicted 430
8 SASI_Mm01_00247645 predicted 417
9 SASI_Mm01_00247646 predicted 242
10 SASI_Mm01_00247647 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978288 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00446589 predicted 348
2 SASI_Mm02_00446590 predicted 257
3 SASI_Mm02_00446591 predicted 343
4 SASI_Mm02_00446592 predicted 276
5 SASI_Mm02_00446593 predicted 385
6 SASI_Mm02_00446594 predicted 275
7 SASI_Mm02_00446595 predicted 236
8 SASI_Mm02_00446596 predicted 378
9 SASI_Mm02_00446597 predicted 386
10 SASI_Mm02_00446598 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_133560
PGPEP1L MISSION shRNA Bacterial Glycerol Stock
pyroglutamyl-peptidase I-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133560.3-558s1c1
Sequence:CCGGGCGAGTCATCATCCAAGAAATCTCGAGATTTCTTGGATGATGACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133560.3-579s1c1
Sequence:CCGGGCTGGAAGAAATCGGGAAAGTCTCGAGACTTTCCCGATTTCTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133560.3-403s1c1
Sequence:CCGGGAGAATGTCGAAGTGGCCTTTCTCGAGAAAGGCCACTTCGACATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133560.3-444s1c1
Sequence:CCGGCATCTGCGATTACACCTACTACTCGAGTAGTAGGTGTAATCGCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133560.3-268s1c1
Sequence:CCGGTGTGGTAAGAACCGAGGCTATCTCGAGATAGCCTCGGTTCTTACCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_133560
PGPEP1L MISSION shRNA shRNA Plasmid DNA
pyroglutamyl-peptidase I-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133560.3-558s1c1
Sequence:CCGGGCGAGTCATCATCCAAGAAATCTCGAGATTTCTTGGATGATGACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133560.3-579s1c1
Sequence:CCGGGCTGGAAGAAATCGGGAAAGTCTCGAGACTTTCCCGATTTCTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133560.3-403s1c1
Sequence:CCGGGAGAATGTCGAAGTGGCCTTTCTCGAGAAAGGCCACTTCGACATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133560.3-444s1c1
Sequence:CCGGCATCTGCGATTACACCTACTACTCGAGTAGTAGGTGTAATCGCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133560.3-268s1c1
Sequence:CCGGTGTGGTAAGAACCGAGGCTATCTCGAGATAGCCTCGGTTCTTACCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_133560
PGPEP1L MISSION shRNA Lentiviral Transduction Particles
pyroglutamyl-peptidase I-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133560.3-558s1c1
Sequence:CCGGGCGAGTCATCATCCAAGAAATCTCGAGATTTCTTGGATGATGACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133560.3-579s1c1
Sequence:CCGGGCTGGAAGAAATCGGGAAAGTCTCGAGACTTTCCCGATTTCTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133560.3-403s1c1
Sequence:CCGGGAGAATGTCGAAGTGGCCTTTCTCGAGAAAGGCCACTTCGACATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133560.3-444s1c1
Sequence:CCGGCATCTGCGATTACACCTACTACTCGAGTAGTAGGTGTAATCGCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133560.3-268s1c1
Sequence:CCGGTGTGGTAAGAACCGAGGCTATCTCGAGATAGCCTCGGTTCTTACCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030101
PGPEP1L MISSION shRNA Bacterial Glycerol Stock
pyroglutamyl-peptidase I-like
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000449021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030101.1-769s21c1
Sequence:CCGGCAGAATCACAATCTTACTTTACTCGAGTAAAGTAAGATTGTGATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030101.1-351s21c1
Sequence:CCGGAGTGAGGCTGTCTGTTGTCAACTCGAGTTGACAACAGACAGCCTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030101
PGPEP1L MISSION shRNA shRNA Plasmid DNA
pyroglutamyl-peptidase I-like
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000449021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030101.1-769s21c1
Sequence:CCGGCAGAATCACAATCTTACTTTACTCGAGTAAAGTAAGATTGTGATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030101.1-351s21c1
Sequence:CCGGAGTGAGGCTGTCTGTTGTCAACTCGAGTTGACAACAGACAGCCTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030101
PGPEP1L MISSION shRNA Lentiviral Transduction Particles
pyroglutamyl-peptidase I-like
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000449021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030101.1-769s21c1
Sequence:CCGGCAGAATCACAATCTTACTTTACTCGAGTAAAGTAAGATTGTGATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030101.1-351s21c1
Sequence:CCGGAGTGAGGCTGTCTGTTGTCAACTCGAGTTGACAACAGACAGCCTCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102612
PGPEP1L MISSION shRNA Bacterial Glycerol Stock
pyroglutamyl-peptidase I-like
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000264009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102612.1-574s21c1
Sequence:CCGGGCAGATACGTCTGTGATTATACTCGAGTATAATCACAGACGTATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102612.1-742s21c1
Sequence:CCGGACAGAGCCCAGTTCGAAGAAACTCGAGTTTCTTCGAACTGGGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102612.1-638s21c1
Sequence:CCGGCATCCATGTCCCTCCACTATCCTCGAGGATAGTGGAGGGACATGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102612.1-825s21c1
Sequence:CCGGTGAATGTTTCAATCCTGTATGCTCGAGCATACAGGATTGAAACATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102612
PGPEP1L MISSION shRNA shRNA Plasmid DNA
pyroglutamyl-peptidase I-like
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000264009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102612.1-574s21c1
Sequence:CCGGGCAGATACGTCTGTGATTATACTCGAGTATAATCACAGACGTATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102612.1-742s21c1
Sequence:CCGGACAGAGCCCAGTTCGAAGAAACTCGAGTTTCTTCGAACTGGGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102612.1-638s21c1
Sequence:CCGGCATCCATGTCCCTCCACTATCCTCGAGGATAGTGGAGGGACATGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102612.1-825s21c1
Sequence:CCGGTGAATGTTTCAATCCTGTATGCTCGAGCATACAGGATTGAAACATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102612
PGPEP1L MISSION shRNA Lentiviral Transduction Particles
pyroglutamyl-peptidase I-like
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000264009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102612.1-574s21c1
Sequence:CCGGGCAGATACGTCTGTGATTATACTCGAGTATAATCACAGACGTATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102612.1-742s21c1
Sequence:CCGGACAGAGCCCAGTTCGAAGAAACTCGAGTTTCTTCGAACTGGGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102612.1-638s21c1
Sequence:CCGGCATCCATGTCCCTCCACTATCCTCGAGGATAGTGGAGGGACATGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102612.1-825s21c1
Sequence:CCGGTGAATGTTTCAATCCTGTATGCTCGAGCATACAGGATTGAAACATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)