EMAIL THIS PAGE TO A FRIEND

PGR

progesterone receptor

187 Gene Product Result for
Synonyms: NR3C3 PR
UniProtKB ID: P06401, A7LQ08, A7X8B0, B4E3T0, Q9UPF7
Gene ID:
Human(5241) Summary: This gene encodes a member of the steroid receptor superfamily. The encoded protein mediates the physiological effects of progesterone, which plays a central role in reproductive events associated with the establishment and maintenance of pregnancy. This gene uses two distinct promotors and translation start sites in the first exon to produce two isoforms, A and B. The two isoforms are identical except for the additional 165 amino acids found in the N-terminus of isoform B and mediate their own response genes and physiologic effects with little overlap. [provided by RefSeq, Jan 2011]
Mouse(18667) progesterone receptor
Rat(25154) progesterone receptor
Zebrafish(569575) progesterone receptor
dog(403621) progesterone receptor
chicken(396198) progesterone receptor
domestic cat(101098742) progesterone receptor
Horse(100033883) progesterone receptor
domestic cat(493830) progesterone receptor
cow(100848466) progesterone receptor-like
naked mole-rat(101723243) progesterone receptor
Domestic Rabbit(100009094) progesterone receptor
domestic guinea pig(100724945) progesterone receptor
domestic guinea pig(100462900) progesterone receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300348 Anti-PGR (Ab-190) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
HPA017176 Anti-PGR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
HPA004751 Anti-PGR antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
HPA008428 Anti-PGR antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
SAB4300056 Anti-phospho-PGR (pSer190) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
P5289 Anti-Progesterone antibody produced in rabbit whole antiserum, lyophilized powder human
radioimmunoassay pricing
MABS1235 Anti-Progesterone Receptor A/B Antibody, clone 488/H3 clone 488/H3, from mouse human
immunocytochemistry, western blot pricing
GW22679 Anti-Progesterone Receptor antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4502184 Anti-Progesterone Receptor antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4502185 Anti-Progesterone Receptor antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502186 Anti-Progesterone Receptor antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB5500165 Anti-Progesterone Receptor antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP2, tissue culture supernatant human (tested)
immunohistochemistry pricing
SAB5500166 Anti-Progesterone Receptor antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP42, tissue culture supernatant human (tested)
immunohistochemistry pricing
MABS1234 Anti-Progesterone Receptor B Antibody, clone 250/H11 clone 250/H11, from mouse human
immunocytochemistry, western blot pricing
AMAB91529 Monoclonal Anti-PGR antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL8721, purified immunoglobulin, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
SAB1400206 Monoclonal Anti-PGR antibody produced in mouse clone 5D10, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1400207 Monoclonal Anti-PGR antibody produced in mouse clone 4E9, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0005241M1 Monoclonal Anti-PGR antibody produced in mouse clone 3E11, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404196 Monoclonal Anti-PGR, (N-terminal) antibody produced in mouse clone 2C2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
P3492 Monoclonal Anti-phospho-Progesterone Receptor (pSer190) antibody produced in mouse ~1 mg/mL, clone 1154, purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, immunoprecipitation (IP), western blot pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
46525 19-Norethindrone VETRANAL®, analytical standard human pricing
46527 19-Norethindrone acetate VETRANAL®, analytical standard human pricing
N6127 19-Norethindrone acetate human pricing
BP688 Cyproterone acetate British Pharmacopoeia (BP) Reference Standard human pricing
C3283000 Cyproterone acetate European Pharmacopoeia (EP) Reference Standard human pricing
Y0001390 Cyproterone acetate for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0000509 Desogestrel European Pharmacopoeia (EP) Reference Standard human pricing
PHR1830 Desogestrel Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1173235 Desogestrel United States Pharmacopeia (USP) Reference Standard human pricing
32809 Desogestrel VETRANAL®, analytical standard human pricing
BP568 Desogestrel British Pharmacopoeia (BP) Reference Standard human pricing
Y0000510 Desogestrel for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
BP816 Desogestrel impurity D British Pharmacopoeia (BP) Reference Standard human pricing
1173268 Desogestrel Related Compound C United States Pharmacopeia (USP) Reference Standard human pricing
1229409 Drospirenone United States Pharmacopeia (USP) Reference Standard human pricing
SML0147 Drospirenone ≥98% (HPLC) human pricing
Y0001105 Drospirenone European Pharmacopoeia (EP) Reference Standard human pricing
Y0001718 Drospirenone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
BP1131 Ethynodiol diacetate British Pharmacopoeia (BP) Reference Standard human pricing
1268003 Ethynodiol diacetate United States Pharmacopeia (USP) Reference Standard human pricing
E7263 Ethynodiol diacetate human pricing
1268783 Etonogestrel United States Pharmacopeia (USP) Reference Standard human pricing
SML0356 Etonogestrel ≥98% (HPLC) human pricing
1329006 Hydroxyprogesterone caproate United States Pharmacopeia (USP) Reference Standard human pricing
PHR1850 Levonorgestrel Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1362602 Levonorgestrel United States Pharmacopeia (USP) Reference Standard human pricing
L0551000 Levonorgestrel European Pharmacopoeia (EP) Reference Standard human pricing
BP501 Levonorgestrel British Pharmacopoeia (BP) Reference Standard human pricing
Y0001618 Levonorgestrel for system suitability 2 European Pharmacopoeia (EP) Reference Standard human pricing
46412 Medroxyprogesterone 17-acetate VETRANAL®, analytical standard human pricing
1378001 Medroxyprogesterone acetate United States Pharmacopeia (USP) Reference Standard human pricing
M0250000 Medroxyprogesterone acetate European Pharmacopoeia (EP) Reference Standard human pricing
BP221 Medroxyprogesterone acetate British Pharmacopoeia (BP) Reference Standard human pricing
M0250010 Medroxyprogesterone acetate for performance test, European Pharmacopoeia (EP) Reference Standard human pricing
PHR1589 Medroxyprogesterone Acetate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0001484 Medroxyprogesterone acetate for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0000598 Medroxyprogesterone acetate for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
M0513 Megestrol acetate analytical standard, for drug analysis human pricing
BP223 Megestrol acetate British Pharmacopoeia (BP) Reference Standard human pricing
Y0001514 Megestrol acetate European Pharmacopoeia (EP) Reference Standard human pricing
1379106 Megestrol acetate United States Pharmacopeia (USP) Reference Standard human pricing
46420 Megestrol acetate VETRANAL®, analytical standard human pricing
PHR1583 Megestrol Acetate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0001507 Megestrol acetate for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0001524 Megestrol acetate for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
SML0550 Nestorone ≥97% (HPLC) human pricing
1469005 Norethindrone United States Pharmacopeia (USP) Reference Standard human pricing
PHR1714 Norethindrone (Norethisterone) Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1470004 Norethindrone acetate United States Pharmacopeia (USP) Reference Standard human pricing
N1200000 Norethisterone European Pharmacopoeia (EP) Reference Standard human pricing
BP266 Norethisterone British Pharmacopoeia (BP) Reference Standard human pricing
BP267 Norethisterone acetate British Pharmacopoeia (BP) Reference Standard human pricing
N1225000 Norethisterone acetate European Pharmacopoeia (EP) Reference Standard human pricing
Y0001532 Norethisterone acetate for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
Y0000522 Norethisterone for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR2119 Norgestimate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
SML0359 Norgestimate ≥97% (HPLC) human pricing
PHR1142 Progesterone Pharmaceutical Secondary Standard; Certified Reference Material human pricing
V900699 Progesterone Vetec, reagent grade, 98% human pricing
1568007 Progesterone United States Pharmacopeia (USP) Reference Standard human pricing
P3300000 Progesterone European Pharmacopoeia (EP) Reference Standard human pricing
46665 Progesterone VETRANAL®, analytical standard human pricing
BP449 Progesterone British Pharmacopoeia (BP) Reference Standard human pricing
Y0001666 Progesterone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0001665 Progesterone for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
P-069 Progesterone solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C3412 Cyproterone acetate ≥98% human, mouse, rat pricing
N2260 D(−)-Norgestrel analytical standard human, rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
M8046 Mifepristone ≥98% human, mouse, rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
M1629 Medroxyprogesterone 17-acetate ≥97% (HPLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000926 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008829 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008829 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008829 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000926 Rosetta Predictions human pricing
NM_022847 Rosetta Predictions rat pricing
XM_579464 Rosetta Predictions rat pricing
NM_008829 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109868 predicted 3304
2 SASI_Hs01_00109872 predicted 3378
3 SASI_Hs02_00303510 predicted 2522
4 SASI_Hs01_00109869 predicted 2556
5 SASI_Hs02_00303511 predicted 2987
6 SASI_Hs01_00109870 predicted 2798
7 SASI_Hs01_00109871 predicted 3602
8 SASI_Hs01_00109874 predicted 3178
9 SASI_Hs01_00109876 predicted 2892
10 SASI_Hs02_00303512 predicted 2910
11 SASI_Hs01_00109873 predicted 3926
12 SASI_Hs01_00109875 predicted 3672
13 SASI_Hs01_00109877 predicted 3834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263561 predicted 2215
2 SASI_Rn01_00101174 predicted 2001
3 SASI_Rn01_00101175 predicted 2685
4 SASI_Rn01_00101176 predicted 2433
5 SASI_Rn01_00101177 predicted 2207
6 SASI_Rn01_00101178 predicted 1112
7 SASI_Rn01_00101179 predicted 2153
8 SASI_Rn01_00101180 predicted 2163
9 SASI_Rn01_00101181 predicted 1882
10 SASI_Rn01_00101182 predicted 2367
11 SASI_Rn01_00101173 predicted 2644
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579464 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171887 predicted 2701
2 SASI_Rn01_00171888 predicted 2339
3 SASI_Rn01_00171889 predicted 2615
4 SASI_Rn01_00171890 predicted 2196
5 SASI_Rn01_00171891 predicted 2441
6 SASI_Rn01_00171892 predicted 2213
7 SASI_Rn01_00171893 predicted 2166
8 SASI_Rn01_00171894 predicted 2174
9 SASI_Rn01_00171895 predicted 2380
10 SASI_Rn01_00171896 predicted 2314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067115 predicted 3065
2 SASI_Mm01_00067116 predicted 2805
3 SASI_Mm01_00067117 predicted 3074
4 SASI_Mm02_00314765 predicted 3214
5 SASI_Mm01_00067118 predicted 2345
6 SASI_Mm01_00067119 predicted 3055
7 SASI_Mm01_00067120 predicted 2945
8 SASI_Mm01_00067121 predicted 2782
9 SASI_Mm01_00067123 predicted 2845
10 SASI_Mm02_00314766 predicted 3280
11 SASI_Mm01_00067114 predicted 2220
12 SASI_Mm01_00067122 predicted 1888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000926
PGR MISSION shRNA Bacterial Glycerol Stock
progesterone receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000926.4-1671s21c1
Sequence:CCGGCCTCTCAATCACGCCTTATTGCTCGAGCAATAAGGCGTGATTGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000926.x-3789s1c1
Sequence:CCGGGCACCTGATCTAATACTAAATCTCGAGATTTAGTATTAGATCAGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000926.4-2409s21c1
Sequence:CCGGCAATACAGCTTCGAGTCATTACTCGAGTAATGACTCGAAGCTGTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000926.x-2420s1c1
Sequence:CCGGGCTGCTGGAAGACGAAAGTTACTCGAGTAACTTTCGTCTTCCAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000926.x-3956s1c1
Sequence:CCGGGCTACGAAGTCAAACCCAGTTCTCGAGAACTGGGTTTGACTTCGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000926.4-2531s21c1
Sequence:CCGGAGGGCAGCACAACTACTTATGCTCGAGCATAAGTAGTTGTGCTGCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000926.x-4194s1c1
Sequence:CCGGGCTGCACAATTACCCAAGATACTCGAGTATCTTGGGTAATTGTGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000926.x-4573s1c1
Sequence:CCGGCATCTAACAAATCATCGACTTCTCGAGAAGTCGATGATTTGTTAGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000926
PGR MISSION shRNA shRNA Plasmid DNA
progesterone receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000926.4-1671s21c1
Sequence:CCGGCCTCTCAATCACGCCTTATTGCTCGAGCAATAAGGCGTGATTGAGAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000003324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000926.x-3789s1c1
Sequence:CCGGGCACCTGATCTAATACTAAATCTCGAGATTTAGTATTAGATCAGGTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000436004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000926.4-2409s21c1
Sequence:CCGGCAATACAGCTTCGAGTCATTACTCGAGTAATGACTCGAAGCTGTATTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000926.x-2420s1c1
Sequence:CCGGGCTGCTGGAAGACGAAAGTTACTCGAGTAACTTTCGTCTTCCAGCAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000003323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000926.x-3956s1c1
Sequence:CCGGGCTACGAAGTCAAACCCAGTTCTCGAGAACTGGGTTTGACTTCGTAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000414666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000926.4-2531s21c1
Sequence:CCGGAGGGCAGCACAACTACTTATGCTCGAGCATAAGTAGTTGTGCTGCCCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000003322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000926.x-4194s1c1
Sequence:CCGGGCTGCACAATTACCCAAGATACTCGAGTATCTTGGGTAATTGTGCAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000003321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000926.x-4573s1c1
Sequence:CCGGCATCTAACAAATCATCGACTTCTCGAGAAGTCGATGATTTGTTAGATGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000926
PGR MISSION shRNA Lentiviral Transduction Particles
progesterone receptor
Human
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000415652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000926.4-1671s21c1
Sequence:CCGGCCTCTCAATCACGCCTTATTGCTCGAGCAATAAGGCGTGATTGAGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000926.x-3789s1c1
Sequence:CCGGGCACCTGATCTAATACTAAATCTCGAGATTTAGTATTAGATCAGGTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000926.4-2409s21c1
Sequence:CCGGCAATACAGCTTCGAGTCATTACTCGAGTAATGACTCGAAGCTGTATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000926.x-2420s1c1
Sequence:CCGGGCTGCTGGAAGACGAAAGTTACTCGAGTAACTTTCGTCTTCCAGCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000926.x-3956s1c1
Sequence:CCGGGCTACGAAGTCAAACCCAGTTCTCGAGAACTGGGTTTGACTTCGTAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000926.4-2531s21c1
Sequence:CCGGAGGGCAGCACAACTACTTATGCTCGAGCATAAGTAGTTGTGCTGCCCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000926.x-4194s1c1
Sequence:CCGGGCTGCACAATTACCCAAGATACTCGAGTATCTTGGGTAATTGTGCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003321    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000926.x-4573s1c1
Sequence:CCGGCATCTAACAAATCATCGACTTCTCGAGAAGTCGATGATTTGTTAGATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008829
PGR MISSION shRNA Bacterial Glycerol Stock
progesterone receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008829.1-815s1c1
Sequence:CCGGCCAAAGGAAGATTCACGGTTTCTCGAGAAACCGTGAATCTTCCTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008829.1-2493s1c1
Sequence:CCGGGCCAGTTTGAAGAGATGAGATCTCGAGATCTCATCTCTTCAAACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008829.1-2524s1c1
Sequence:CCGGCCGCGAATTGATCAAGGCAATCTCGAGATTGCCTTGATCAATTCGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008829.1-2160s1c1
Sequence:CCGGCAGTAGTCAAATGGTCTAAATCTCGAGATTTAGACCATTTGACTACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008829.1-2312s1c1
Sequence:CCGGGCACCTGATCTAATCCTAAATCTCGAGATTTAGGATTAGATCAGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008829
PGR MISSION shRNA shRNA Plasmid DNA
progesterone receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008829.1-815s1c1
Sequence:CCGGCCAAAGGAAGATTCACGGTTTCTCGAGAAACCGTGAATCTTCCTTTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000026003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008829.1-2493s1c1
Sequence:CCGGGCCAGTTTGAAGAGATGAGATCTCGAGATCTCATCTCTTCAAACTGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008829.1-2524s1c1
Sequence:CCGGCCGCGAATTGATCAAGGCAATCTCGAGATTGCCTTGATCAATTCGCGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000026017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008829.1-2160s1c1
Sequence:CCGGCAGTAGTCAAATGGTCTAAATCTCGAGATTTAGACCATTTGACTACTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008829.1-2312s1c1
Sequence:CCGGGCACCTGATCTAATCCTAAATCTCGAGATTTAGGATTAGATCAGGTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008829
PGR MISSION shRNA Lentiviral Transduction Particles
progesterone receptor
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000026032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008829.1-815s1c1
Sequence:CCGGCCAAAGGAAGATTCACGGTTTCTCGAGAAACCGTGAATCTTCCTTTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008829.1-2493s1c1
Sequence:CCGGGCCAGTTTGAAGAGATGAGATCTCGAGATCTCATCTCTTCAAACTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008829.1-2524s1c1
Sequence:CCGGCCGCGAATTGATCAAGGCAATCTCGAGATTGCCTTGATCAATTCGCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008829.1-2160s1c1
Sequence:CCGGCAGTAGTCAAATGGTCTAAATCTCGAGATTTAGACCATTTGACTACTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008829.1-2312s1c1
Sequence:CCGGGCACCTGATCTAATCCTAAATCTCGAGATTTAGGATTAGATCAGGTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)