EMAIL THIS PAGE TO A FRIEND

PGS1

phosphatidylglycerophosphate synthase 1

125 Gene Product Result for
Gene ID:
Mouse(74451) phosphatidylglycerophosphate synthase 1
Rat(303698) phosphatidylglycerophosphate synthase 1
chicken(422087) phosphatidylglycerophosphate synthase 1
domestic cat(101082107) phosphatidylglycerophosphate synthase 1
Horse(100057717) phosphatidylglycerophosphate synthase 1
dog(475920) phosphatidylglycerophosphate synthase 1
cow(535126) phosphatidylglycerophosphate synthase 1
sheep(101113511) phosphatidylglycerophosphate synthase 1
naked mole-rat(101704870) phosphatidylglycerophosphate synthase 1
domestic guinea pig(100731635) phosphatidylglycerophosphate synthase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133757 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133757 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133757 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024419 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024419 Rosetta Predictions human pricing
XM_001081747 Rosetta Predictions rat pricing
XM_221142 Rosetta Predictions rat pricing
NM_133757 Rosetta Predictions mouse pricing
XM_895026 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240706 predicted 913
2 SASI_Hs01_00240707 predicted 776
3 SASI_Hs01_00240708 predicted 1054
4 SASI_Hs01_00240709 predicted 462
5 SASI_Hs01_00240710 predicted 456
6 SASI_Hs01_00240711 predicted 663
7 SASI_Hs01_00240712 predicted 522
8 SASI_Hs01_00240713 predicted 1072
9 SASI_Hs01_00240714 predicted 1455
10 SASI_Hs02_00356731 predicted 266
11 SASI_Hs01_00240715 predicted 1195
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373285 predicted 1270
2 SASI_Rn02_00373286 predicted 1281
3 SASI_Rn02_00373287 predicted 566
4 SASI_Rn02_00373288 predicted 626
5 SASI_Rn02_00373289 predicted 1289
6 SASI_Rn02_00373290 predicted 870
7 SASI_Rn02_00373291 predicted 971
8 SASI_Rn02_00373292 predicted 645
9 SASI_Rn02_00373293 predicted 1655
10 SASI_Rn02_00373294 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379904 predicted 1491
2 SASI_Rn02_00379905 predicted 1492
3 SASI_Rn02_00379906 predicted 777
4 SASI_Rn02_00379907 predicted 842
5 SASI_Rn02_00379908 predicted 317
6 SASI_Rn02_00379909 predicted 1496
7 SASI_Rn02_00379910 predicted 1083
8 SASI_Rn02_00379911 predicted 227
9 SASI_Rn02_00379912 predicted 861
10 SASI_Rn02_00379913 predicted 1871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338743 predicted 420
2 SASI_Mm02_00338744 predicted 366
3 SASI_Mm02_00338745 predicted 775
4 SASI_Mm02_00338746 predicted 1083
5 SASI_Mm02_00338747 predicted 1078
6 SASI_Mm02_00338748 predicted 425
7 SASI_Mm02_00338749 predicted 1088
8 SASI_Mm02_00338750 predicted 671
9 SASI_Mm02_00338751 predicted 915
10 SASI_Mm02_00338752 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895026 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248683 predicted 988
2 SASI_Mm01_00248684 predicted 944
3 SASI_Mm01_00248685 predicted 1347
4 SASI_Mm01_00248686 predicted 2243
5 SASI_Mm01_00248687 predicted 1658
6 SASI_Mm01_00248688 predicted 1648
7 SASI_Mm01_00248689 predicted 1659
8 SASI_Mm01_00248690 predicted 1236
9 SASI_Mm01_00248691 predicted 1488
10 SASI_Mm01_00248692 predicted 2026
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133757
VALIDATED
PGS1 MISSION shRNA Bacterial Glycerol Stock
phosphatidylglycerophosphate synthase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133757.2-1460s21c1
Sequence:CCGGGCTGATTGGCTCTCCTAATTTCTCGAGAAATTAGGAGAGCCAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133757.2-454s21c1
Sequence:CCGGAGTCACTCCAAGCGAAGTTTCCTCGAGGAAACTTCGCTTGGAGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133757.2-617s21c1
Sequence:CCGGAGGACTCCTCCGACTCCTTATCTCGAGATAAGGAGTCGGAGGAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133757.2-2010s21c1
Sequence:CCGGGGTGACTCTGCATGCCGTAATCTCGAGATTACGGCATGCAGAGTCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133757.2-673s21c1
Sequence:CCGGACATCAAGGTGTACCTCTTTGCTCGAGCAAAGAGGTACACCTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133757
VALIDATED
PGS1 MISSION shRNA shRNA Plasmid DNA
phosphatidylglycerophosphate synthase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133757.2-1460s21c1
Sequence:CCGGGCTGATTGGCTCTCCTAATTTCTCGAGAAATTAGGAGAGCCAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133757.2-454s21c1
Sequence:CCGGAGTCACTCCAAGCGAAGTTTCCTCGAGGAAACTTCGCTTGGAGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133757.2-617s21c1
Sequence:CCGGAGGACTCCTCCGACTCCTTATCTCGAGATAAGGAGTCGGAGGAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133757.2-2010s21c1
Sequence:CCGGGGTGACTCTGCATGCCGTAATCTCGAGATTACGGCATGCAGAGTCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133757.2-673s21c1
Sequence:CCGGACATCAAGGTGTACCTCTTTGCTCGAGCAAAGAGGTACACCTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133757
VALIDATED
PGS1 MISSION shRNA Lentiviral Transduction Particles
phosphatidylglycerophosphate synthase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133757.2-1460s21c1
Sequence:CCGGGCTGATTGGCTCTCCTAATTTCTCGAGAAATTAGGAGAGCCAATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133757.2-454s21c1
Sequence:CCGGAGTCACTCCAAGCGAAGTTTCCTCGAGGAAACTTCGCTTGGAGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133757.2-617s21c1
Sequence:CCGGAGGACTCCTCCGACTCCTTATCTCGAGATAAGGAGTCGGAGGAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133757.2-2010s21c1
Sequence:CCGGGGTGACTCTGCATGCCGTAATCTCGAGATTACGGCATGCAGAGTCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133757.2-673s21c1
Sequence:CCGGACATCAAGGTGTACCTCTTTGCTCGAGCAAAGAGGTACACCTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024419
VALIDATED
PGS1 MISSION shRNA Bacterial Glycerol Stock
phosphatidylglycerophosphate synthase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024419.3-1058s21c1
Sequence:CCGGCCTGGATTTATCCGCTGATTCCTCGAGGAATCAGCGGATAAATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024419.3-1083s21c1
Sequence:CCGGGAAGCCCTTCGAGATTCAAATCTCGAGATTTGAATCTCGAAGGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024419.3-1458s21c1
Sequence:CCGGGCTGATTGGCTCTCCTAATTTCTCGAGAAATTAGGAGAGCCAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024419.3-657s21c1
Sequence:CCGGCATCGGCCTCCAGCACATTAACTCGAGTTAATGTGCTGGAGGCCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024419.3-2014s21c1
Sequence:CCGGTCGGGTTCCATCCGTTTAAATCTCGAGATTTAAACGGATGGAACCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_024419.2-1061s1c1
Sequence:CCGGCGAGATTCAAATCGATGAGATCTCGAGATCTCATCGATTTGAATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_024419.2-400s1c1
Sequence:CCGGGCCTGGAAAGTACTCTAGAAACTCGAGTTTCTAGAGTACTTTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_024419.2-1026s1c1
Sequence:CCGGACCTGGATTTATCCGCTGATTCTCGAGAATCAGCGGATAAATCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024419.2-1061s1c2
Sequence:CCGGCGAGATTCAAATCGATGAGATCTCGAGATCTCATCGATTTGAATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_024419.2-638s1c1
Sequence:CCGGGCACATTAAGGTGTACCTCTTCTCGAGAAGAGGTACACCTTAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024419
VALIDATED
PGS1 MISSION shRNA shRNA Plasmid DNA
phosphatidylglycerophosphate synthase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024419.3-1058s21c1
Sequence:CCGGCCTGGATTTATCCGCTGATTCCTCGAGGAATCAGCGGATAAATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024419.3-1083s21c1
Sequence:CCGGGAAGCCCTTCGAGATTCAAATCTCGAGATTTGAATCTCGAAGGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024419.3-1458s21c1
Sequence:CCGGGCTGATTGGCTCTCCTAATTTCTCGAGAAATTAGGAGAGCCAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024419.3-657s21c1
Sequence:CCGGCATCGGCCTCCAGCACATTAACTCGAGTTAATGTGCTGGAGGCCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024419.3-2014s21c1
Sequence:CCGGTCGGGTTCCATCCGTTTAAATCTCGAGATTTAAACGGATGGAACCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_024419.2-1061s1c1
Sequence:CCGGCGAGATTCAAATCGATGAGATCTCGAGATCTCATCGATTTGAATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_024419.2-400s1c1
Sequence:CCGGGCCTGGAAAGTACTCTAGAAACTCGAGTTTCTAGAGTACTTTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_024419.2-1026s1c1
Sequence:CCGGACCTGGATTTATCCGCTGATTCTCGAGAATCAGCGGATAAATCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024419.2-1061s1c2
Sequence:CCGGCGAGATTCAAATCGATGAGATCTCGAGATCTCATCGATTTGAATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_024419.2-638s1c1
Sequence:CCGGGCACATTAAGGTGTACCTCTTCTCGAGAAGAGGTACACCTTAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024419
VALIDATED
PGS1 MISSION shRNA Lentiviral Transduction Particles
phosphatidylglycerophosphate synthase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024419.3-1058s21c1
Sequence:CCGGCCTGGATTTATCCGCTGATTCCTCGAGGAATCAGCGGATAAATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024419.3-1083s21c1
Sequence:CCGGGAAGCCCTTCGAGATTCAAATCTCGAGATTTGAATCTCGAAGGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024419.3-1458s21c1
Sequence:CCGGGCTGATTGGCTCTCCTAATTTCTCGAGAAATTAGGAGAGCCAATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024419.3-657s21c1
Sequence:CCGGCATCGGCCTCCAGCACATTAACTCGAGTTAATGTGCTGGAGGCCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024419.3-2014s21c1
Sequence:CCGGTCGGGTTCCATCCGTTTAAATCTCGAGATTTAAACGGATGGAACCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_024419.2-1061s1c1
Sequence:CCGGCGAGATTCAAATCGATGAGATCTCGAGATCTCATCGATTTGAATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_024419.2-400s1c1
Sequence:CCGGGCCTGGAAAGTACTCTAGAAACTCGAGTTTCTAGAGTACTTTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_024419.2-1026s1c1
Sequence:CCGGACCTGGATTTATCCGCTGATTCTCGAGAATCAGCGGATAAATCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024419.2-1061s1c2
Sequence:CCGGCGAGATTCAAATCGATGAGATCTCGAGATCTCATCGATTTGAATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_024419.2-638s1c1
Sequence:CCGGGCACATTAAGGTGTACCTCTTCTCGAGAAGAGGTACACCTTAATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)