EMAIL THIS PAGE TO A FRIEND

PHACTR2

phosphatase and actin regulator 2

180 Gene Product Result for
Synonyms: C6orf56
Gene ID:
Mouse(215789) phosphatase and actin regulator 2
Rat(308291) phosphatase and actin regulator 2
naked mole-rat(101722296) phosphatase and actin regulator 2
domestic guinea pig(100733020) phosphatase and actin regulator 2
cow(522158) phosphatase and actin regulator 2
sheep(101118620) phosphatase and actin regulator 2
Zebrafish(570136) phosphatase and actin regulator 2
domestic cat(101091942) phosphatase and actin regulator 2
dog(476230) phosphatase and actin regulator 2
chicken(421667) phosphatase and actin regulator 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001100164 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001100164 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001100164 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033257 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033257 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033257 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_376540 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376540 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376540 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100164 Rosetta Predictions human pricing
NM_001100165 Rosetta Predictions human pricing
NM_001100166 Rosetta Predictions human pricing
NM_014721 Rosetta Predictions human pricing
NM_214458 Rosetta Predictions rat pricing
NM_001033257 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321764 predicted 1485
2 SASI_Hs02_00321765 predicted 2228
3 SASI_Hs02_00321766 predicted 1753
4 SASI_Hs02_00321767 predicted 2214
5 SASI_Hs02_00321768 predicted 2121
6 SASI_Hs02_00321769 predicted 1940
7 SASI_Hs02_00321770 predicted 1386
8 SASI_Hs02_00321771 predicted 2202
9 SASI_Hs02_00321772 predicted 1954
10 SASI_Hs02_00321773 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321774 predicted 1246
2 SASI_Hs02_00321775 predicted 1992
3 SASI_Hs02_00321776 predicted 1515
4 SASI_Hs02_00321777 predicted 1980
5 SASI_Hs02_00321778 predicted 1872
6 SASI_Hs02_00321779 predicted 1694
7 SASI_Hs02_00321780 predicted 1146
8 SASI_Hs02_00321781 predicted 1959
9 SASI_Hs02_00321782 predicted 1715
10 SASI_Hs02_00321783 predicted 1260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321784 predicted 1143
2 SASI_Hs02_00321785 predicted 1889
3 SASI_Hs02_00321786 predicted 1412
4 SASI_Hs02_00321787 predicted 1873
5 SASI_Hs02_00321788 predicted 1774
6 SASI_Hs02_00321789 predicted 1601
7 SASI_Hs02_00321790 predicted 1040
8 SASI_Hs02_00321791 predicted 1861
9 SASI_Hs02_00321792 predicted 1606
10 SASI_Hs02_00321793 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229808 predicted 1389
2 SASI_Hs01_00229809 predicted 2131
3 SASI_Hs01_00229810 predicted 1657
4 SASI_Hs01_00229811 predicted 2115
5 SASI_Hs01_00229812 predicted 2012
6 SASI_Hs01_00229814 predicted 1832
7 SASI_Hs01_00229815 predicted 1282
8 SASI_Hs01_00229817 predicted 2097
9 SASI_Hs02_00346154 predicted 1853
10 SASI_Hs02_00346155 predicted 1400
11 SASI_Hs01_00229813 predicted 1900
12 SASI_Hs01_00229816 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_214458 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117608 predicted 662
2 SASI_Rn01_00117609 predicted 1526
3 SASI_Rn01_00117610 predicted 228
4 SASI_Rn01_00117611 predicted 1529
5 SASI_Rn01_00117612 predicted 300
6 SASI_Rn01_00117613 predicted 725
7 SASI_Rn01_00117614 predicted 292
8 SASI_Rn01_00117615 predicted 1496
9 SASI_Rn01_00117616 predicted 379
10 SASI_Rn01_00117617 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033257 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138021 predicted 1813
2 SASI_Mm01_00138022 predicted 1678
3 SASI_Mm01_00138023 predicted 1723
4 SASI_Mm01_00138024 predicted 1548
5 SASI_Mm01_00138025 predicted 1723
6 SASI_Mm01_00138026 predicted 334
7 SASI_Mm01_00138027 predicted 1562
8 SASI_Mm01_00138028 predicted 327
9 SASI_Mm01_00138029 predicted 416
10 SASI_Mm01_00138030 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100164
PHACTR2 MISSION shRNA Bacterial Glycerol Stock
phosphatase and actin regulator 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100164.1-1659s21c1
Sequence:GTACCGGGGGATACTCTTGCTATCAAACCTCGAGGTTTGATAGCAAGAGTATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100164.1-1494s21c1
Sequence:CCGGGCGAATCTTCAGAATCCTTTACTCGAGTAAAGGATTCTGAAGATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100164.1-410s21c1
Sequence:CCGGGCAGTATTAGAAAGGAAGATACTCGAGTATCTTCCTTTCTAATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100164.1-2372s21c1
Sequence:CCGGGTAAGAGACACCGTGGATATTCTCGAGAATATCCACGGTGTCTCTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100164.1-378s21c1
Sequence:GTACCGGAGAAGACCAGCGACAAATTTACTCGAGTAAATTTGTCGCTGGTCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100164.1-1955s21c1
Sequence:CCGGCGATTTAACGAGTATGTAGAACTCGAGTTCTACATACTCGTTAAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100164
PHACTR2 MISSION shRNA shRNA Plasmid DNA
phosphatase and actin regulator 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100164.1-1659s21c1
Sequence:GTACCGGGGGATACTCTTGCTATCAAACCTCGAGGTTTGATAGCAAGAGTATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100164.1-1494s21c1
Sequence:CCGGGCGAATCTTCAGAATCCTTTACTCGAGTAAAGGATTCTGAAGATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100164.1-410s21c1
Sequence:CCGGGCAGTATTAGAAAGGAAGATACTCGAGTATCTTCCTTTCTAATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100164.1-2372s21c1
Sequence:CCGGGTAAGAGACACCGTGGATATTCTCGAGAATATCCACGGTGTCTCTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100164.1-378s21c1
Sequence:GTACCGGAGAAGACCAGCGACAAATTTACTCGAGTAAATTTGTCGCTGGTCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100164.1-1955s21c1
Sequence:CCGGCGATTTAACGAGTATGTAGAACTCGAGTTCTACATACTCGTTAAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100164
PHACTR2 MISSION shRNA Lentiviral Transduction Particles
phosphatase and actin regulator 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100164.1-1659s21c1
Sequence:GTACCGGGGGATACTCTTGCTATCAAACCTCGAGGTTTGATAGCAAGAGTATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100164.1-1494s21c1
Sequence:CCGGGCGAATCTTCAGAATCCTTTACTCGAGTAAAGGATTCTGAAGATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100164.1-410s21c1
Sequence:CCGGGCAGTATTAGAAAGGAAGATACTCGAGTATCTTCCTTTCTAATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100164.1-2372s21c1
Sequence:CCGGGTAAGAGACACCGTGGATATTCTCGAGAATATCCACGGTGTCTCTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100164.1-378s21c1
Sequence:GTACCGGAGAAGACCAGCGACAAATTTACTCGAGTAAATTTGTCGCTGGTCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100164.1-1955s21c1
Sequence:CCGGCGATTTAACGAGTATGTAGAACTCGAGTTCTACATACTCGTTAAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033257
VALIDATED
PHACTR2 MISSION shRNA Bacterial Glycerol Stock
phosphatase and actin regulator 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033257.3-699s21c1
Sequence:CCGGTTCTGACACGCCTAGTCTTAACTCGAGTTAAGACTAGGCGTGTCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033257.3-1749s21c1
Sequence:CCGGCGTGGAACTGCTCGGAAATAACTCGAGTTATTTCCGAGCAGTTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033257.3-1427s21c1
Sequence:CCGGTAGAGCAAAGAAACATCTTAACTCGAGTTAAGATGTTTCTTTGCTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033257.3-1703s21c1
Sequence:CCGGATGAAGAGAGTCGACAGTTTACTCGAGTAAACTGTCGACTCTCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033257.3-95s21c1
Sequence:CCGGGCGTTGATGGACTAGACAAAGCTCGAGCTTTGTCTAGTCCATCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033257
VALIDATED
PHACTR2 MISSION shRNA shRNA Plasmid DNA
phosphatase and actin regulator 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033257.3-699s21c1
Sequence:CCGGTTCTGACACGCCTAGTCTTAACTCGAGTTAAGACTAGGCGTGTCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033257.3-1749s21c1
Sequence:CCGGCGTGGAACTGCTCGGAAATAACTCGAGTTATTTCCGAGCAGTTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033257.3-1427s21c1
Sequence:CCGGTAGAGCAAAGAAACATCTTAACTCGAGTTAAGATGTTTCTTTGCTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033257.3-1703s21c1
Sequence:CCGGATGAAGAGAGTCGACAGTTTACTCGAGTAAACTGTCGACTCTCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033257.3-95s21c1
Sequence:CCGGGCGTTGATGGACTAGACAAAGCTCGAGCTTTGTCTAGTCCATCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033257
VALIDATED
PHACTR2 MISSION shRNA Lentiviral Transduction Particles
phosphatase and actin regulator 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033257.3-699s21c1
Sequence:CCGGTTCTGACACGCCTAGTCTTAACTCGAGTTAAGACTAGGCGTGTCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033257.3-1749s21c1
Sequence:CCGGCGTGGAACTGCTCGGAAATAACTCGAGTTATTTCCGAGCAGTTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033257.3-1427s21c1
Sequence:CCGGTAGAGCAAAGAAACATCTTAACTCGAGTTAAGATGTTTCTTTGCTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033257.3-1703s21c1
Sequence:CCGGATGAAGAGAGTCGACAGTTTACTCGAGTAAACTGTCGACTCTCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033257.3-95s21c1
Sequence:CCGGGCGTTGATGGACTAGACAAAGCTCGAGCTTTGTCTAGTCCATCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376540
VALIDATED
PHACTR2 MISSION shRNA Bacterial Glycerol Stock
phosphatase and actin regulator 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376540.1-387s1c1
Sequence:CCGGGCAGTATTAGAAAGGAAGATACTCGAGTATCTTCCTTTCTAATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:XM_376540.1-1736s1c1
Sequence:CCGGCCGACAACAAATTGGAACCAACTCGAGTTGGTTCCAATTTGTTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_376540.1-1471s1c1
Sequence:CCGGGCGAATCTTCAGAATCCTTTACTCGAGTAAAGGATTCTGAAGATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:XM_376540.1-1230s1c1
Sequence:CCGGCCTCTTGAGGATCAGTGCATTCTCGAGAATGCACTGATCCTCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_376540.1-1932s1c1
Sequence:CCGGCGATTTAACGAGTATGTAGAACTCGAGTTCTACATACTCGTTAAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376540
VALIDATED
PHACTR2 MISSION shRNA shRNA Plasmid DNA
phosphatase and actin regulator 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376540.1-387s1c1
Sequence:CCGGGCAGTATTAGAAAGGAAGATACTCGAGTATCTTCCTTTCTAATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:XM_376540.1-1736s1c1
Sequence:CCGGCCGACAACAAATTGGAACCAACTCGAGTTGGTTCCAATTTGTTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_376540.1-1471s1c1
Sequence:CCGGGCGAATCTTCAGAATCCTTTACTCGAGTAAAGGATTCTGAAGATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:XM_376540.1-1230s1c1
Sequence:CCGGCCTCTTGAGGATCAGTGCATTCTCGAGAATGCACTGATCCTCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_376540.1-1932s1c1
Sequence:CCGGCGATTTAACGAGTATGTAGAACTCGAGTTCTACATACTCGTTAAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376540
VALIDATED
PHACTR2 MISSION shRNA Lentiviral Transduction Particles
phosphatase and actin regulator 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376540.1-387s1c1
Sequence:CCGGGCAGTATTAGAAAGGAAGATACTCGAGTATCTTCCTTTCTAATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:XM_376540.1-1736s1c1
Sequence:CCGGCCGACAACAAATTGGAACCAACTCGAGTTGGTTCCAATTTGTTGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_376540.1-1471s1c1
Sequence:CCGGGCGAATCTTCAGAATCCTTTACTCGAGTAAAGGATTCTGAAGATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:XM_376540.1-1230s1c1
Sequence:CCGGCCTCTTGAGGATCAGTGCATTCTCGAGAATGCACTGATCCTCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_376540.1-1932s1c1
Sequence:CCGGCGATTTAACGAGTATGTAGAACTCGAGTTCTACATACTCGTTAAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)