EMAIL THIS PAGE TO A FRIEND

PHACTR3

phosphatase and actin regulator 3

141 Gene Product Result for
Synonyms: C20orf101 H17739 SCAPIN1 SCAPININ
Gene ID:
Human(116154) Summary: The protein encoded by this gene is associated with the nuclear scaffold in proliferating cells. It was found to bind to the catalytic subunit of protein phosphatase-1 (PP1) and inhibit PP1 activity, suggesting that this protein may function as a regulatory subunit of PP1. Alternative splicing at this locus results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(74189) phosphatase and actin regulator 3
Rat(362284) phosphatase and actin regulator 3
chicken(770781) phosphatase and actin regulator 3
Horse(100050984) phosphatase and actin regulator 3
domestic cat(101097962) phosphatase and actin regulator 3
dog(612028) phosphatase and actin regulator 3
cow(515071) phosphatase and actin regulator 3
sheep(101114041) phosphatase and actin regulator 3
domestic guinea pig(100721574) phosphatase and actin regulator 3
naked mole-rat(101723069) phosphatase and actin regulator 3
Domestic Rabbit(100349112) phosphatase and actin regulator 3
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080672 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001007154 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001007154 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001007154 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU057321 MISSION® esiRNA esiRNA targeting mouse Phactr3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080672 Rosetta Predictions human pricing
NM_183244 Rosetta Predictions human pricing
NM_183246 Rosetta Predictions human pricing
NM_214459 Rosetta Predictions rat pricing
XM_579746 Rosetta Predictions rat pricing
NM_001007154 Rosetta Predictions mouse pricing
NM_028806 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191884 predicted 2055
2 SASI_Hs01_00191885 predicted 2208
3 SASI_Hs01_00191886 predicted 2161
4 SASI_Hs01_00191887 predicted 2156
5 SASI_Hs02_00362440 predicted 1685
6 SASI_Hs01_00191888 predicted 2112
7 SASI_Hs01_00191889 predicted 1885
8 SASI_Hs01_00191890 predicted 2087
9 SASI_Hs01_00191891 predicted 2061
10 SASI_Hs01_00191893 predicted 1961
11 SASI_Hs01_00191892 predicted 1895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231530 predicted 1695
2 SASI_Hs01_00231531 predicted 1849
3 SASI_Hs01_00231532 predicted 1805
4 SASI_Hs01_00231533 predicted 1794
5 SASI_Hs02_00371256 predicted 1326
6 SASI_Hs01_00231534 predicted 1764
7 SASI_Hs01_00231535 predicted 1529
8 SASI_Hs01_00231536 predicted 1730
9 SASI_Hs01_00231537 predicted 1699
10 SASI_Hs01_00231539 predicted 1604
11 SASI_Hs01_00231538 predicted 1542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210583 predicted 1486
2 SASI_Hs01_00210584 predicted 1637
3 SASI_Hs01_00210585 predicted 1595
4 SASI_Hs01_00210586 predicted 1584
5 SASI_Hs02_00371258 predicted 1117
6 SASI_Hs01_00210587 predicted 1553
7 SASI_Hs01_00210588 predicted 1322
8 SASI_Hs01_00210589 predicted 1521
9 SASI_Hs01_00210590 predicted 1489
10 SASI_Hs01_00210592 predicted 1394
11 SASI_Hs01_00210591 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_214459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065532 predicted 485
2 SASI_Rn01_00065533 predicted 825
3 SASI_Rn01_00065534 predicted 1261
4 SASI_Rn02_00270634 predicted 1338
5 SASI_Rn01_00065535 predicted 600
6 SASI_Rn01_00065536 predicted 1176
7 SASI_Rn01_00065537 predicted 233
8 SASI_Rn02_00270635 predicted 793
9 SASI_Rn01_00065538 predicted 1215
10 SASI_Rn01_00065539 predicted 510
11 SASI_Rn01_00065530 predicted 1042
12 SASI_Rn01_00065531 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579746 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00180599 predicted 618
2 SASI_Rn01_00180600 predicted 577
3 SASI_Rn01_00180601 predicted 405
4 SASI_Rn01_00180602 predicted 844
5 SASI_Rn01_00180603 predicted 751
6 SASI_Rn01_00180604 predicted 375
7 SASI_Rn01_00180605 predicted 854
8 SASI_Rn01_00180606 predicted 799
9 SASI_Rn01_00180607 predicted 591
10 SASI_Rn01_00180608 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187228 predicted 583
2 SASI_Mm01_00187230 predicted 1503
3 SASI_Mm01_00187231 predicted 1628
4 SASI_Mm01_00187232 predicted 1692
5 SASI_Mm01_00187233 predicted 1537
6 SASI_Mm01_00187234 predicted 1553
7 SASI_Mm01_00187235 predicted 1188
8 SASI_Mm01_00187236 predicted 1086
9 SASI_Mm01_00187237 predicted 993
10 SASI_Mm02_00286714 predicted 1662
11 SASI_Mm01_00187229 predicted 1737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167690 predicted 898
2 SASI_Mm01_00167692 predicted 1827
3 SASI_Mm01_00167693 predicted 1953
4 SASI_Mm01_00167694 predicted 2012
5 SASI_Mm01_00167695 predicted 1862
6 SASI_Mm01_00167696 predicted 1879
7 SASI_Mm01_00167697 predicted 1512
8 SASI_Mm01_00167698 predicted 1406
9 SASI_Mm01_00167699 predicted 1315
10 SASI_Mm02_00334420 predicted 1978
11 SASI_Mm01_00167691 predicted 2061
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080672
PHACTR3 MISSION shRNA Bacterial Glycerol Stock
phosphatase and actin regulator 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080672.2-1285s1c1
Sequence:CCGGGCGCTGAACGACTCCATTATTCTCGAGAATAATGGAGTCGTTCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080672.2-1916s1c1
Sequence:CCGGGCTGTGTTTGTGAGAAGAGTACTCGAGTACTCTTCTCACAAACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080672.2-1200s1c1
Sequence:CCGGCGCTAAGGAATCTGAGGAGAACTCGAGTTCTCCTCAGATTCCTTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080672.2-1366s1c1
Sequence:CCGGCCAAGCAAACAGGAACTAGAACTCGAGTTCTAGTTCCTGTTTGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080672.2-1711s1c1
Sequence:CCGGGCAGCAGATAAGGCAGCAATTCTCGAGAATTGCTGCCTTATCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080672.3-1924s21c1
Sequence:CCGGGACCCACTGTTGATGAATTAACTCGAGTTAATTCATCAACAGTGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080672.3-2285s21c1
Sequence:CCGGTGCAATCTTGACCACACTTACCTCGAGGTAAGTGTGGTCAAGATTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080672.3-1959s21c1
Sequence:CCGGCTGATACGATTCAGTGATTACCTCGAGGTAATCACTGAATCGTATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080672.3-2184s21c1
Sequence:CCGGTGATACCAACACTGAACATTCCTCGAGGAATGTTCAGTGTTGGTATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080672.3-1640s21c1
Sequence:CCGGTGGAACACTGCCACGGAAATGCTCGAGCATTTCCGTGGCAGTGTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080672
PHACTR3 MISSION shRNA shRNA Plasmid DNA
phosphatase and actin regulator 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080672.2-1285s1c1
Sequence:CCGGGCGCTGAACGACTCCATTATTCTCGAGAATAATGGAGTCGTTCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080672.2-1916s1c1
Sequence:CCGGGCTGTGTTTGTGAGAAGAGTACTCGAGTACTCTTCTCACAAACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080672.2-1200s1c1
Sequence:CCGGCGCTAAGGAATCTGAGGAGAACTCGAGTTCTCCTCAGATTCCTTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080672.2-1366s1c1
Sequence:CCGGCCAAGCAAACAGGAACTAGAACTCGAGTTCTAGTTCCTGTTTGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080672.2-1711s1c1
Sequence:CCGGGCAGCAGATAAGGCAGCAATTCTCGAGAATTGCTGCCTTATCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080672.3-1924s21c1
Sequence:CCGGGACCCACTGTTGATGAATTAACTCGAGTTAATTCATCAACAGTGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080672.3-2285s21c1
Sequence:CCGGTGCAATCTTGACCACACTTACCTCGAGGTAAGTGTGGTCAAGATTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080672.3-1959s21c1
Sequence:CCGGCTGATACGATTCAGTGATTACCTCGAGGTAATCACTGAATCGTATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080672.3-2184s21c1
Sequence:CCGGTGATACCAACACTGAACATTCCTCGAGGAATGTTCAGTGTTGGTATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080672.3-1640s21c1
Sequence:CCGGTGGAACACTGCCACGGAAATGCTCGAGCATTTCCGTGGCAGTGTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080672
PHACTR3 MISSION shRNA Lentiviral Transduction Particles
phosphatase and actin regulator 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080672.2-1285s1c1
Sequence:CCGGGCGCTGAACGACTCCATTATTCTCGAGAATAATGGAGTCGTTCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080672.2-1916s1c1
Sequence:CCGGGCTGTGTTTGTGAGAAGAGTACTCGAGTACTCTTCTCACAAACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080672.2-1200s1c1
Sequence:CCGGCGCTAAGGAATCTGAGGAGAACTCGAGTTCTCCTCAGATTCCTTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080672.2-1366s1c1
Sequence:CCGGCCAAGCAAACAGGAACTAGAACTCGAGTTCTAGTTCCTGTTTGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080672.2-1711s1c1
Sequence:CCGGGCAGCAGATAAGGCAGCAATTCTCGAGAATTGCTGCCTTATCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080672.3-1924s21c1
Sequence:CCGGGACCCACTGTTGATGAATTAACTCGAGTTAATTCATCAACAGTGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080672.3-2285s21c1
Sequence:CCGGTGCAATCTTGACCACACTTACCTCGAGGTAAGTGTGGTCAAGATTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080672.3-1959s21c1
Sequence:CCGGCTGATACGATTCAGTGATTACCTCGAGGTAATCACTGAATCGTATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080672.3-2184s21c1
Sequence:CCGGTGATACCAACACTGAACATTCCTCGAGGAATGTTCAGTGTTGGTATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080672.3-1640s21c1
Sequence:CCGGTGGAACACTGCCACGGAAATGCTCGAGCATTTCCGTGGCAGTGTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007154
PHACTR3 MISSION shRNA Bacterial Glycerol Stock
phosphatase and actin regulator 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000193633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007154.1-2495s1c1
Sequence:CCGGCCTAGAAGGAACTTACTGGAACTCGAGTTCCAGTAAGTTCCTTCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174289    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007154.1-2266s1c1
Sequence:CCGGCAGGAAATGAATAAAGGCTTTCTCGAGAAAGCCTTTATTCATTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007154.1-1422s1c1
Sequence:CCGGCCTGAAACAAAGGAATGATCACTCGAGTGATCATTCCTTTGTTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007154.1-1399s1c1
Sequence:CCGGGAGGAACTGGAGAGAAGAAATCTCGAGATTTCTTCTCTCCAGTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007154
PHACTR3 MISSION shRNA shRNA Plasmid DNA
phosphatase and actin regulator 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000193633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007154.1-2495s1c1
Sequence:CCGGCCTAGAAGGAACTTACTGGAACTCGAGTTCCAGTAAGTTCCTTCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174289    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007154.1-2266s1c1
Sequence:CCGGCAGGAAATGAATAAAGGCTTTCTCGAGAAAGCCTTTATTCATTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007154.1-1422s1c1
Sequence:CCGGCCTGAAACAAAGGAATGATCACTCGAGTGATCATTCCTTTGTTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007154.1-1399s1c1
Sequence:CCGGGAGGAACTGGAGAGAAGAAATCTCGAGATTTCTTCTCTCCAGTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007154
PHACTR3 MISSION shRNA Lentiviral Transduction Particles
phosphatase and actin regulator 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000193633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007154.1-2495s1c1
Sequence:CCGGCCTAGAAGGAACTTACTGGAACTCGAGTTCCAGTAAGTTCCTTCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174289    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007154.1-2266s1c1
Sequence:CCGGCAGGAAATGAATAAAGGCTTTCTCGAGAAAGCCTTTATTCATTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007154.1-1422s1c1
Sequence:CCGGCCTGAAACAAAGGAATGATCACTCGAGTGATCATTCCTTTGTTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007154.1-1399s1c1
Sequence:CCGGGAGGAACTGGAGAGAAGAAATCTCGAGATTTCTTCTCTCCAGTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)