EMAIL THIS PAGE TO A FRIEND

PHACTR4

phosphatase and actin regulator 4

221 Gene Product Result for
Gene ID:
Human(65979) Summary: This gene encodes a member of the phosphatase and actin regulator (PHACTR) family. Other PHACTR family members have been shown to inhibit protein phosphatase 1 (PP1) activity, and the homolog of this gene in the mouse has been shown to interact with actin and PP1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(100169) phosphatase and actin regulator 4
Rat(682920) phosphatase and actin regulator 4
chicken(425087) phosphatase and actin regulator 4
Horse(100070745) phosphatase and actin regulator 4
domestic cat(101091385) phosphatase and actin regulator 4
dog(487333) phosphatase and actin regulator 4
naked mole-rat(101714986) phosphatase and actin regulator 4
domestic guinea pig(100734072) phosphatase and actin regulator 4
cow(514644) phosphatase and actin regulator 4
sheep(101103701) phosphatase and actin regulator 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175306 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175306 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175306 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_023923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023923 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001048183 Rosetta Predictions human pricing
NM_023923 Rosetta Predictions human pricing
XM_001063709 Rosetta Predictions rat pricing
NM_175306 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311602 predicted 816
2 SASI_Hs02_00311603 predicted 1839
3 SASI_Hs02_00311604 predicted 664
4 SASI_Hs02_00311605 predicted 1676
5 SASI_Hs02_00311606 predicted 1966
6 SASI_Hs02_00311607 predicted 1254
7 SASI_Hs02_00311608 predicted 1283
8 SASI_Hs02_00311609 predicted 654
9 SASI_Hs02_00311610 predicted 1924
10 SASI_Hs02_00311611 predicted 1784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175516 predicted 804
2 SASI_Hs01_00175517 predicted 1818
3 SASI_Hs01_00175518 predicted 651
4 SASI_Hs01_00175519 predicted 1659
5 SASI_Hs01_00175520 predicted 1948
6 SASI_Hs01_00175521 predicted 1236
7 SASI_Hs01_00175522 predicted 1267
8 SASI_Hs01_00175523 predicted 634
9 SASI_Hs01_00175524 predicted 1907
10 SASI_Hs01_00175525 predicted 1776
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063709 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308070 predicted 1552
2 SASI_Rn02_00308071 predicted 1617
3 SASI_Rn02_00308072 predicted 2301
4 SASI_Rn02_00308073 predicted 2316
5 SASI_Rn02_00308074 predicted 2307
6 SASI_Rn02_00308075 predicted 2407
7 SASI_Rn02_00308076 predicted 1175
8 SASI_Rn02_00308077 predicted 1211
9 SASI_Rn02_00308078 predicted 1627
10 SASI_Rn02_00308079 predicted 2374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031113 predicted 1628
2 SASI_Mm01_00031114 predicted 2200
3 SASI_Mm01_00031115 predicted 2048
4 SASI_Mm01_00031117 predicted 2020
5 SASI_Mm01_00031118 predicted 2203
6 SASI_Mm01_00031119 predicted 1753
7 SASI_Mm01_00031120 predicted 1269
8 SASI_Mm01_00031121 predicted 1055
9 SASI_Mm01_00031122 predicted 1077
10 SASI_Mm02_00346063 predicted 1478
11 SASI_Mm01_00031116 predicted 1495
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175306
VALIDATED
PHACTR4 MISSION shRNA Bacterial Glycerol Stock
phosphatase and actin regulator 4
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175306.4-1519s21c1
Sequence:CCGGTCACGATTGAGATGTTGAAAGCTCGAGCTTTCAACATCTCAATCGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175306.3-1946s1c1
Sequence:CCGGCACTAGAAAGCTCAGTCAAAGCTCGAGCTTTGACTGAGCTTTCTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175306.2-394s1c1
Sequence:CCGGGCTGAGCCATGCTGCATTAAACTCGAGTTTAATGCAGCATGGCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175306.2-3009s1c1
Sequence:CCGGCCTTACTGTTAATGCCGGTTTCTCGAGAAACCGGCATTAACAGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175306.2-1024s1c1
Sequence:CCGGGTTCACAACTAAGACAGCAAACTCGAGTTTGCTGTCTTAGTTGTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175306.2-1993s1c1
Sequence:CCGGCAGGAAGATTCTGCGGTTTAACTCGAGTTAAACCGCAGAATCTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175306.2-871s1c1
Sequence:CCGGCCCTAAACCAGCTCAGAGAAACTCGAGTTTCTCTGAGCTGGTTTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175306.4-1654s21c1
Sequence:CCGGCAGATTCAGAGGGTCCCATTACTCGAGTAATGGGACCCTCTGAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175306.4-430s21c1
Sequence:CCGGAGCTGAGCCATGCTGCATTAACTCGAGTTAATGCAGCATGGCTCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175306.3-979s1c1
Sequence:CCGGGCATTCCATCAACTTCGATACCTCGAGGTATCGAAGTTGATGGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175306.2-2881s1c1
Sequence:CCGGCCTGATTTCAAAGTGAGCTTACTCGAGTAAGCTCACTTTGAAATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175306
VALIDATED
PHACTR4 MISSION shRNA shRNA Plasmid DNA
phosphatase and actin regulator 4
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175306.4-1519s21c1
Sequence:CCGGTCACGATTGAGATGTTGAAAGCTCGAGCTTTCAACATCTCAATCGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175306.3-1946s1c1
Sequence:CCGGCACTAGAAAGCTCAGTCAAAGCTCGAGCTTTGACTGAGCTTTCTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175306.2-394s1c1
Sequence:CCGGGCTGAGCCATGCTGCATTAAACTCGAGTTTAATGCAGCATGGCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175306.2-3009s1c1
Sequence:CCGGCCTTACTGTTAATGCCGGTTTCTCGAGAAACCGGCATTAACAGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175306.2-1024s1c1
Sequence:CCGGGTTCACAACTAAGACAGCAAACTCGAGTTTGCTGTCTTAGTTGTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175306.2-1993s1c1
Sequence:CCGGCAGGAAGATTCTGCGGTTTAACTCGAGTTAAACCGCAGAATCTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175306.2-871s1c1
Sequence:CCGGCCCTAAACCAGCTCAGAGAAACTCGAGTTTCTCTGAGCTGGTTTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175306.4-1654s21c1
Sequence:CCGGCAGATTCAGAGGGTCCCATTACTCGAGTAATGGGACCCTCTGAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175306.4-430s21c1
Sequence:CCGGAGCTGAGCCATGCTGCATTAACTCGAGTTAATGCAGCATGGCTCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175306.3-979s1c1
Sequence:CCGGGCATTCCATCAACTTCGATACCTCGAGGTATCGAAGTTGATGGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175306.2-2881s1c1
Sequence:CCGGCCTGATTTCAAAGTGAGCTTACTCGAGTAAGCTCACTTTGAAATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175306
VALIDATED
PHACTR4 MISSION shRNA Lentiviral Transduction Particles
phosphatase and actin regulator 4
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175306.4-1519s21c1
Sequence:CCGGTCACGATTGAGATGTTGAAAGCTCGAGCTTTCAACATCTCAATCGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175306.3-1946s1c1
Sequence:CCGGCACTAGAAAGCTCAGTCAAAGCTCGAGCTTTGACTGAGCTTTCTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175306.2-394s1c1
Sequence:CCGGGCTGAGCCATGCTGCATTAAACTCGAGTTTAATGCAGCATGGCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175306.2-3009s1c1
Sequence:CCGGCCTTACTGTTAATGCCGGTTTCTCGAGAAACCGGCATTAACAGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175306.2-1024s1c1
Sequence:CCGGGTTCACAACTAAGACAGCAAACTCGAGTTTGCTGTCTTAGTTGTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175306.2-1993s1c1
Sequence:CCGGCAGGAAGATTCTGCGGTTTAACTCGAGTTAAACCGCAGAATCTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175306.2-871s1c1
Sequence:CCGGCCCTAAACCAGCTCAGAGAAACTCGAGTTTCTCTGAGCTGGTTTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175306.4-1654s21c1
Sequence:CCGGCAGATTCAGAGGGTCCCATTACTCGAGTAATGGGACCCTCTGAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175306.4-430s21c1
Sequence:CCGGAGCTGAGCCATGCTGCATTAACTCGAGTTAATGCAGCATGGCTCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175306.3-979s1c1
Sequence:CCGGGCATTCCATCAACTTCGATACCTCGAGGTATCGAAGTTGATGGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175306.2-2881s1c1
Sequence:CCGGCCTGATTTCAAAGTGAGCTTACTCGAGTAAGCTCACTTTGAAATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023923
VALIDATED
PHACTR4 MISSION shRNA Bacterial Glycerol Stock
phosphatase and actin regulator 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023923.3-2765s21c1
Sequence:CCGGCAAATGTGTAGGCTCTAAATTCTCGAGAATTTAGAGCCTACACATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_023923.3-2332s21c1
Sequence:CCGGTCATGAAGAGAGCAAACATTTCTCGAGAAATGTTTGCTCTCTTCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023923.3-1103s21c1
Sequence:CCGGGCAATAAACAGTGGTACATTGCTCGAGCAATGTACCACTGTTTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023923.3-1548s21c1
Sequence:CCGGCACTTCCCATGACTCCTATTCCTCGAGGAATAGGAGTCATGGGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_023923.3-671s21c1
Sequence:CCGGATTCCAGAAGAGGACCTAAAGCTCGAGCTTTAGGTCCTCTTCTGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_023923.3-2054s21c1
Sequence:CCGGGAACTAGAACAACGCAATATACTCGAGTATATTGCGTTGTTCTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023923.2-573s1c1
Sequence:CCGGCCATAGGGAATGCCAGATCATCTCGAGATGATCTGGCATTCCCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023923.2-1640s1c1
Sequence:CCGGCCCATCACTATTGAAATGCTACTCGAGTAGCATTTCAATAGTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_023923.2-1805s1c1
Sequence:CCGGCCCATTCAGTACCGAGATGAACTCGAGTTCATCTCGGTACTGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023923.2-2045s1c1
Sequence:CCGGCGCAATATATTGCAACCTAAACTCGAGTTTAGGTTGCAATATATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023923
VALIDATED
PHACTR4 MISSION shRNA shRNA Plasmid DNA
phosphatase and actin regulator 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023923.3-2765s21c1
Sequence:CCGGCAAATGTGTAGGCTCTAAATTCTCGAGAATTTAGAGCCTACACATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_023923.3-2332s21c1
Sequence:CCGGTCATGAAGAGAGCAAACATTTCTCGAGAAATGTTTGCTCTCTTCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023923.3-1103s21c1
Sequence:CCGGGCAATAAACAGTGGTACATTGCTCGAGCAATGTACCACTGTTTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023923.3-1548s21c1
Sequence:CCGGCACTTCCCATGACTCCTATTCCTCGAGGAATAGGAGTCATGGGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_023923.3-671s21c1
Sequence:CCGGATTCCAGAAGAGGACCTAAAGCTCGAGCTTTAGGTCCTCTTCTGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_023923.3-2054s21c1
Sequence:CCGGGAACTAGAACAACGCAATATACTCGAGTATATTGCGTTGTTCTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023923.2-573s1c1
Sequence:CCGGCCATAGGGAATGCCAGATCATCTCGAGATGATCTGGCATTCCCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023923.2-1640s1c1
Sequence:CCGGCCCATCACTATTGAAATGCTACTCGAGTAGCATTTCAATAGTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_023923.2-1805s1c1
Sequence:CCGGCCCATTCAGTACCGAGATGAACTCGAGTTCATCTCGGTACTGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023923.2-2045s1c1
Sequence:CCGGCGCAATATATTGCAACCTAAACTCGAGTTTAGGTTGCAATATATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023923
VALIDATED
PHACTR4 MISSION shRNA Lentiviral Transduction Particles
phosphatase and actin regulator 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023923.3-2765s21c1
Sequence:CCGGCAAATGTGTAGGCTCTAAATTCTCGAGAATTTAGAGCCTACACATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_023923.3-2332s21c1
Sequence:CCGGTCATGAAGAGAGCAAACATTTCTCGAGAAATGTTTGCTCTCTTCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023923.3-1103s21c1
Sequence:CCGGGCAATAAACAGTGGTACATTGCTCGAGCAATGTACCACTGTTTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023923.3-1548s21c1
Sequence:CCGGCACTTCCCATGACTCCTATTCCTCGAGGAATAGGAGTCATGGGAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_023923.3-671s21c1
Sequence:CCGGATTCCAGAAGAGGACCTAAAGCTCGAGCTTTAGGTCCTCTTCTGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_023923.3-2054s21c1
Sequence:CCGGGAACTAGAACAACGCAATATACTCGAGTATATTGCGTTGTTCTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023923.2-573s1c1
Sequence:CCGGCCATAGGGAATGCCAGATCATCTCGAGATGATCTGGCATTCCCTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023923.2-1640s1c1
Sequence:CCGGCCCATCACTATTGAAATGCTACTCGAGTAGCATTTCAATAGTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_023923.2-1805s1c1
Sequence:CCGGCCCATTCAGTACCGAGATGAACTCGAGTTCATCTCGGTACTGAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023923.2-2045s1c1
Sequence:CCGGCGCAATATATTGCAACCTAAACTCGAGTTTAGGTTGCAATATATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)