EMAIL THIS PAGE TO A FRIEND

PHAX

phosphorylated adaptor for RNA export

54 Gene Product Result for
Synonyms: RNUXA
UniProtKB ID: Q9H814, Q9H8W1
Gene ID:
Mouse(56698) phosphorylated adaptor for RNA export
Rat(286917) phosphorylated adaptor for RNA export
fruit fly(35926) Phosphorylated adaptor for RNA export
dog(479305) phosphorylated adaptor for RNA export
domestic cat(101086872) phosphorylated adaptor for RNA export
Zebrafish(445490) phosphorylated adaptor for RNA export
chicken(427124) phosphorylated adaptor for RNA export
cow(507478) phosphorylated adaptor for RNA export
sheep(101107861) phosphorylated adaptor for RNA export
domestic guinea pig(100731964) phosphorylated adaptor for RNA export
naked mole-rat(101710598) phosphorylated adaptor for RNA export
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019996 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019996 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019996 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032177 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032177 Rosetta Predictions human pricing
NM_173133 Rosetta Predictions rat pricing
NM_019996 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111498 predicted 531
2 SASI_Hs01_00111499 predicted 805
3 SASI_Hs01_00111500 predicted 791
4 SASI_Hs01_00111501 predicted 240
5 SASI_Hs01_00111502 predicted 329
6 SASI_Hs01_00111503 predicted 345
7 SASI_Hs01_00111504 predicted 457
8 SASI_Hs01_00111505 predicted 1178
9 SASI_Hs01_00111506 predicted 905
10 SASI_Hs01_00111507 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269303 predicted 1252
2 SASI_Rn01_00121395 predicted 220
3 SASI_Rn01_00121396 predicted 571
4 SASI_Rn01_00121397 predicted 614
5 SASI_Rn02_00269304 predicted 1294
6 SASI_Rn01_00121398 predicted 648
7 SASI_Rn01_00121400 predicted 257
8 SASI_Rn02_00269305 predicted 204
9 SASI_Rn01_00121401 predicted 485
10 SASI_Rn01_00121402 predicted 285
11 SASI_Rn01_00121399 predicted 443
12 SASI_Rn01_00121403 predicted 306
13 SASI_Rn01_00121404 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019996 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031203 predicted 645
2 SASI_Mm01_00031204 predicted 217
3 SASI_Mm01_00031206 predicted 201
4 SASI_Mm01_00031207 predicted 496
5 SASI_Mm01_00031208 predicted 675
6 SASI_Mm01_00031209 predicted 445
7 SASI_Mm01_00031210 predicted 555
8 SASI_Mm01_00031211 predicted 406
9 SASI_Mm02_00325341 predicted 612
10 SASI_Mm01_00031212 predicted 482
11 SASI_Mm01_00031205 predicted 1253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019996
VALIDATED
PHAX MISSION shRNA Bacterial Glycerol Stock
phosphorylated adaptor for RNA export
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019996.2-215s1c1
Sequence:CCGGCCGATGACGATTGCTCTCTTTCTCGAGAAAGAGAGCAATCGTCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019996.3-440s21c1
Sequence:CCGGGTCTGAGACCTATAACTATTTCTCGAGAAATAGTTATAGGTCTCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019996.3-771s21c1
Sequence:CCGGGCCATTGAACTTCTGATGGAACTCGAGTTCCATCAGAAGTTCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019996.3-1259s21c1
Sequence:CCGGGTGTACTGAGACTAGAGAAAGCTCGAGCTTTCTCTAGTCTCAGTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019996.2-1371s1c1
Sequence:CCGGCGGCACGGGTTAAATCTCATTCTCGAGAATGAGATTTAACCCGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019996.2-449s1c1
Sequence:CCGGCCTATAACTATTTGCTTGCTACTCGAGTAGCAAGCAAATAGTTATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019996.2-772s1c1
Sequence:CCGGGCCATTGAACTTCTGATGGAACTCGAGTTCCATCAGAAGTTCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019996.2-441s1c1
Sequence:CCGGGTCTGAGACCTATAACTATTTCTCGAGAAATAGTTATAGGTCTCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019996.3-214s21c1
Sequence:CCGGCCGATGACGATTGCTCTCTTTCTCGAGAAAGAGAGCAATCGTCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019996.3-150s21c1
Sequence:CCGGTGCGCACCGGTGTCACATTATCTCGAGATAATGTGACACCGGTGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019996
VALIDATED
PHAX MISSION shRNA shRNA Plasmid DNA
phosphorylated adaptor for RNA export
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019996.2-215s1c1
Sequence:CCGGCCGATGACGATTGCTCTCTTTCTCGAGAAAGAGAGCAATCGTCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019996.3-440s21c1
Sequence:CCGGGTCTGAGACCTATAACTATTTCTCGAGAAATAGTTATAGGTCTCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019996.3-771s21c1
Sequence:CCGGGCCATTGAACTTCTGATGGAACTCGAGTTCCATCAGAAGTTCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019996.3-1259s21c1
Sequence:CCGGGTGTACTGAGACTAGAGAAAGCTCGAGCTTTCTCTAGTCTCAGTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019996.2-1371s1c1
Sequence:CCGGCGGCACGGGTTAAATCTCATTCTCGAGAATGAGATTTAACCCGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019996.2-449s1c1
Sequence:CCGGCCTATAACTATTTGCTTGCTACTCGAGTAGCAAGCAAATAGTTATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019996.2-772s1c1
Sequence:CCGGGCCATTGAACTTCTGATGGAACTCGAGTTCCATCAGAAGTTCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019996.2-441s1c1
Sequence:CCGGGTCTGAGACCTATAACTATTTCTCGAGAAATAGTTATAGGTCTCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019996.3-214s21c1
Sequence:CCGGCCGATGACGATTGCTCTCTTTCTCGAGAAAGAGAGCAATCGTCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019996.3-150s21c1
Sequence:CCGGTGCGCACCGGTGTCACATTATCTCGAGATAATGTGACACCGGTGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019996
VALIDATED
PHAX MISSION shRNA Lentiviral Transduction Particles
phosphorylated adaptor for RNA export
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019996.2-215s1c1
Sequence:CCGGCCGATGACGATTGCTCTCTTTCTCGAGAAAGAGAGCAATCGTCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019996.3-440s21c1
Sequence:CCGGGTCTGAGACCTATAACTATTTCTCGAGAAATAGTTATAGGTCTCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019996.3-771s21c1
Sequence:CCGGGCCATTGAACTTCTGATGGAACTCGAGTTCCATCAGAAGTTCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019996.3-1259s21c1
Sequence:CCGGGTGTACTGAGACTAGAGAAAGCTCGAGCTTTCTCTAGTCTCAGTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019996.2-1371s1c1
Sequence:CCGGCGGCACGGGTTAAATCTCATTCTCGAGAATGAGATTTAACCCGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019996.2-449s1c1
Sequence:CCGGCCTATAACTATTTGCTTGCTACTCGAGTAGCAAGCAAATAGTTATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019996.2-772s1c1
Sequence:CCGGGCCATTGAACTTCTGATGGAACTCGAGTTCCATCAGAAGTTCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019996.2-441s1c1
Sequence:CCGGGTCTGAGACCTATAACTATTTCTCGAGAAATAGTTATAGGTCTCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019996.3-214s21c1
Sequence:CCGGCCGATGACGATTGCTCTCTTTCTCGAGAAAGAGAGCAATCGTCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019996.3-150s21c1
Sequence:CCGGTGCGCACCGGTGTCACATTATCTCGAGATAATGTGACACCGGTGCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032177
VALIDATED
PHAX MISSION shRNA Bacterial Glycerol Stock
phosphorylated adaptor for RNA export
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032177.2-464s1c1
Sequence:CCGGCAATCCGAGACCTACAATTATCTCGAGATAATTGTAGGTCTCGGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032177.2-761s1c1
Sequence:CCGGGCCCGAGTAGTGAGGATTATTCTCGAGAATAATCCTCACTACTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032177.2-240s1c1
Sequence:CCGGCAGATGATGATAGCTGTCTTTCTCGAGAAAGACAGCTATCATCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032177.2-417s1c1
Sequence:CCGGCTGAACTTGGTATCTTGGGAACTCGAGTTCCCAAGATACCAAGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032177.2-1412s1c1
Sequence:CCGGGCACAGGATTTAATTTCTCAACTCGAGTTGAGAAATTAAATCCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032177
VALIDATED
PHAX MISSION shRNA shRNA Plasmid DNA
phosphorylated adaptor for RNA export
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032177.2-464s1c1
Sequence:CCGGCAATCCGAGACCTACAATTATCTCGAGATAATTGTAGGTCTCGGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032177.2-761s1c1
Sequence:CCGGGCCCGAGTAGTGAGGATTATTCTCGAGAATAATCCTCACTACTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032177.2-240s1c1
Sequence:CCGGCAGATGATGATAGCTGTCTTTCTCGAGAAAGACAGCTATCATCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032177.2-417s1c1
Sequence:CCGGCTGAACTTGGTATCTTGGGAACTCGAGTTCCCAAGATACCAAGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032177.2-1412s1c1
Sequence:CCGGGCACAGGATTTAATTTCTCAACTCGAGTTGAGAAATTAAATCCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032177
VALIDATED
PHAX MISSION shRNA Lentiviral Transduction Particles
phosphorylated adaptor for RNA export
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032177.2-464s1c1
Sequence:CCGGCAATCCGAGACCTACAATTATCTCGAGATAATTGTAGGTCTCGGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032177.2-761s1c1
Sequence:CCGGGCCCGAGTAGTGAGGATTATTCTCGAGAATAATCCTCACTACTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032177.2-240s1c1
Sequence:CCGGCAGATGATGATAGCTGTCTTTCTCGAGAAAGACAGCTATCATCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032177.2-417s1c1
Sequence:CCGGCTGAACTTGGTATCTTGGGAACTCGAGTTCCCAAGATACCAAGTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032177.2-1412s1c1
Sequence:CCGGGCACAGGATTTAATTTCTCAACTCGAGTTGAGAAATTAAATCCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)