EMAIL THIS PAGE TO A FRIEND

PHB2

prohibitin 2

73 Gene Product Result for
Synonyms: BAP BCAP37 Bap37 PNAS-141 REA p22
UniProtKB ID: Q99623, B4DP75, Q2YDA4, Q7KYU3, Q92978
Gene ID:
Mouse(12034) prohibitin 2
Rat(114766) prohibitin 2
Thale Cress(839228) prohibitin 2
Zebrafish(324421) prohibitin 2
chicken(771124) prohibitin 2
dog(486716) prohibitin 2
cow(515363) prohibitin 2
sheep(101108041) prohibitin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007273 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007273 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007273 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007531 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007531 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007531 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104281 MISSION® esiRNA esiRNA human PHB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007273 Rosetta Predictions human pricing
NM_001013035 Rosetta Predictions rat pricing
NM_007531 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020381 predicted 579
2 SASI_Hs01_00020382 predicted 911
3 SASI_Hs01_00020383 predicted 1007
4 SASI_Hs01_00020384 predicted 569
5 SASI_Hs01_00020385 predicted 287
6 SASI_Hs01_00020387 predicted 973
7 SASI_Hs01_00020388 predicted 758
8 SASI_Hs01_00020389 predicted 476
9 SASI_Hs01_00020390 predicted 1020
10 SASI_Hs02_00343323 predicted 498
11 SASI_Hs01_00020386 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067080 predicted 1005
2 SASI_Rn01_00067081 predicted 520
3 SASI_Rn01_00067082 predicted 655
4 SASI_Rn01_00067083 predicted 264
5 SASI_Rn01_00067084 predicted 443
6 SASI_Rn01_00067085 predicted 228
7 SASI_Rn01_00067087 predicted 957
8 SASI_Rn01_00067088 predicted 282
9 SASI_Rn01_00067089 predicted 941
10 SASI_Rn02_00200618 predicted 923
11 SASI_Rn01_00067086 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007531 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033287 predicted 879
2 SASI_Mm01_00033288 predicted 1072
3 SASI_Mm01_00033289 predicted 868
4 SASI_Mm01_00033290 predicted 541
5 SASI_Mm01_00033292 predicted 948
6 SASI_Mm01_00033293 predicted 252
7 SASI_Mm02_00311852 predicted 624
8 SASI_Mm01_00033294 predicted 718
9 SASI_Mm01_00033295 predicted 940
10 SASI_Mm02_00311853 predicted 973
11 SASI_Mm01_00033291 predicted 294
12 SASI_Mm01_00033296 predicted 924
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007273
VALIDATED
PHB2 MISSION shRNA Bacterial Glycerol Stock
prohibitin 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007273.3-503s1c1
Sequence:CCGGGCGAGTGTTGTCTCGACCCAACTCGAGTTGGGTCGAGACAACACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_007273.3-956s1c1
Sequence:CCGGCCAGAATATCTCCAAGACGATCTCGAGATCGTCTTGGAGATATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007273.3-1063s1c1
Sequence:CCGGGCCTCATCAAGGGTAAGAAATCTCGAGATTTCTTACCCTTGATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007273.3-537s1c1
Sequence:CCGGCCTAGCATGTACCAGCGCCTACTCGAGTAGGCGCTGGTACATGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_007273.3-743s1c1
Sequence:CCGGGCTGAGCTTTAGCCGAGAGTACTCGAGTACTCTCGGCTAAAGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007273.3-1063s21c1
Sequence:CCGGGCCTCATCAAGGGTAAGAAATCTCGAGATTTCTTACCCTTGATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_007273.3-743s21c1
Sequence:CCGGGCTGAGCTTTAGCCGAGAGTACTCGAGTACTCTCGGCTAAAGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007273.3-956s21c1
Sequence:CCGGCCAGAATATCTCCAAGACGATCTCGAGATCGTCTTGGAGATATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_007273.3-537s21c1
Sequence:CCGGCCTAGCATGTACCAGCGCCTACTCGAGTAGGCGCTGGTACATGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007273
VALIDATED
PHB2 MISSION shRNA shRNA Plasmid DNA
prohibitin 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007273.3-503s1c1
Sequence:CCGGGCGAGTGTTGTCTCGACCCAACTCGAGTTGGGTCGAGACAACACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_007273.3-956s1c1
Sequence:CCGGCCAGAATATCTCCAAGACGATCTCGAGATCGTCTTGGAGATATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007273.3-1063s1c1
Sequence:CCGGGCCTCATCAAGGGTAAGAAATCTCGAGATTTCTTACCCTTGATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007273.3-537s1c1
Sequence:CCGGCCTAGCATGTACCAGCGCCTACTCGAGTAGGCGCTGGTACATGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_007273.3-743s1c1
Sequence:CCGGGCTGAGCTTTAGCCGAGAGTACTCGAGTACTCTCGGCTAAAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007273.3-1063s21c1
Sequence:CCGGGCCTCATCAAGGGTAAGAAATCTCGAGATTTCTTACCCTTGATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_007273.3-743s21c1
Sequence:CCGGGCTGAGCTTTAGCCGAGAGTACTCGAGTACTCTCGGCTAAAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007273.3-956s21c1
Sequence:CCGGCCAGAATATCTCCAAGACGATCTCGAGATCGTCTTGGAGATATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_007273.3-537s21c1
Sequence:CCGGCCTAGCATGTACCAGCGCCTACTCGAGTAGGCGCTGGTACATGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007273
VALIDATED
PHB2 MISSION shRNA Lentiviral Transduction Particles
prohibitin 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007273.3-503s1c1
Sequence:CCGGGCGAGTGTTGTCTCGACCCAACTCGAGTTGGGTCGAGACAACACTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_007273.3-956s1c1
Sequence:CCGGCCAGAATATCTCCAAGACGATCTCGAGATCGTCTTGGAGATATTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007273.3-1063s1c1
Sequence:CCGGGCCTCATCAAGGGTAAGAAATCTCGAGATTTCTTACCCTTGATGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007273.3-537s1c1
Sequence:CCGGCCTAGCATGTACCAGCGCCTACTCGAGTAGGCGCTGGTACATGCTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_007273.3-743s1c1
Sequence:CCGGGCTGAGCTTTAGCCGAGAGTACTCGAGTACTCTCGGCTAAAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_007273.3-1063s21c1
Sequence:CCGGGCCTCATCAAGGGTAAGAAATCTCGAGATTTCTTACCCTTGATGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_007273.3-743s21c1
Sequence:CCGGGCTGAGCTTTAGCCGAGAGTACTCGAGTACTCTCGGCTAAAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007273.3-956s21c1
Sequence:CCGGCCAGAATATCTCCAAGACGATCTCGAGATCGTCTTGGAGATATTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_007273.3-537s21c1
Sequence:CCGGCCTAGCATGTACCAGCGCCTACTCGAGTAGGCGCTGGTACATGCTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007531
VALIDATED
PHB2 MISSION shRNA Bacterial Glycerol Stock
prohibitin 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007531.1-927s1c1
Sequence:CCGGGCTGACAACCTTGTGCTGAATCTCGAGATTCAGCACAAGGTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007531.1-1099s1c1
Sequence:CCGGAGGCATCATGTGATGGACTTTCTCGAGAAAGTCCATCACATGATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007531.1-828s1c1
Sequence:CCGGCTGAGCAAGAATCCTGGCTATCTCGAGATAGCCAGGATTCTTGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007531.1-456s1c1
Sequence:CCGGCCCAGCATGTACCAGCGTCTACTCGAGTAGACGCTGGTACATGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007531.1-982s1c1
Sequence:CCGGGCCTCATTAAGGGTAAGAAATCTCGAGATTTCTTACCCTTAATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007531.2-1026s21c1
Sequence:CCGGGCCTCATTAAGGGTAAGAAATCTCGAGATTTCTTACCCTTAATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007531.2-1144s21c1
Sequence:CCGGAGGCATCATGTGATGGACTTTCTCGAGAAAGTCCATCACATGATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007531.2-971s21c1
Sequence:CCGGGCTGACAACCTTGTGCTGAATCTCGAGATTCAGCACAAGGTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007531.2-872s21c1
Sequence:CCGGCTGAGCAAGAATCCTGGCTATCTCGAGATAGCCAGGATTCTTGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007531
VALIDATED
PHB2 MISSION shRNA shRNA Plasmid DNA
prohibitin 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007531.1-927s1c1
Sequence:CCGGGCTGACAACCTTGTGCTGAATCTCGAGATTCAGCACAAGGTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007531.1-1099s1c1
Sequence:CCGGAGGCATCATGTGATGGACTTTCTCGAGAAAGTCCATCACATGATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007531.1-828s1c1
Sequence:CCGGCTGAGCAAGAATCCTGGCTATCTCGAGATAGCCAGGATTCTTGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007531.1-456s1c1
Sequence:CCGGCCCAGCATGTACCAGCGTCTACTCGAGTAGACGCTGGTACATGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007531.1-982s1c1
Sequence:CCGGGCCTCATTAAGGGTAAGAAATCTCGAGATTTCTTACCCTTAATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007531.2-1026s21c1
Sequence:CCGGGCCTCATTAAGGGTAAGAAATCTCGAGATTTCTTACCCTTAATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007531.2-1144s21c1
Sequence:CCGGAGGCATCATGTGATGGACTTTCTCGAGAAAGTCCATCACATGATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007531.2-971s21c1
Sequence:CCGGGCTGACAACCTTGTGCTGAATCTCGAGATTCAGCACAAGGTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007531.2-872s21c1
Sequence:CCGGCTGAGCAAGAATCCTGGCTATCTCGAGATAGCCAGGATTCTTGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007531
VALIDATED
PHB2 MISSION shRNA Lentiviral Transduction Particles
prohibitin 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007531.1-927s1c1
Sequence:CCGGGCTGACAACCTTGTGCTGAATCTCGAGATTCAGCACAAGGTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007531.1-1099s1c1
Sequence:CCGGAGGCATCATGTGATGGACTTTCTCGAGAAAGTCCATCACATGATGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007531.1-828s1c1
Sequence:CCGGCTGAGCAAGAATCCTGGCTATCTCGAGATAGCCAGGATTCTTGCTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007531.1-456s1c1
Sequence:CCGGCCCAGCATGTACCAGCGTCTACTCGAGTAGACGCTGGTACATGCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007531.1-982s1c1
Sequence:CCGGGCCTCATTAAGGGTAAGAAATCTCGAGATTTCTTACCCTTAATGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007531.2-1026s21c1
Sequence:CCGGGCCTCATTAAGGGTAAGAAATCTCGAGATTTCTTACCCTTAATGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007531.2-1144s21c1
Sequence:CCGGAGGCATCATGTGATGGACTTTCTCGAGAAAGTCCATCACATGATGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007531.2-971s21c1
Sequence:CCGGGCTGACAACCTTGTGCTGAATCTCGAGATTCAGCACAAGGTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007531.2-872s21c1
Sequence:CCGGCTGAGCAAGAATCCTGGCTATCTCGAGATAGCCAGGATTCTTGCTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)