EMAIL THIS PAGE TO A FRIEND

PHC1

polyhomeotic homolog 1 (Drosophila)

181 Gene Product Result for
Synonyms: EDR1 HPH1 RAE28
UniProtKB ID: P78364, D3DUV4, Q8WVM3, Q9BU63
Gene ID:
Human(1911) Summary: This gene is a homolog of the Drosophila polyhomeotic gene, which is a member of the Polycomb group of genes. The gene product is a component of a multimeric protein complex that contains EDR2 and the vertebrate Polycomb protein BMH1. The gene product, the EDR2 protein, and the Drosophila polyhomeotic protein share 2 highly conserved domains, named homology domains I and II. These domains are involved in protein-protein interactions and may mediate heterodimerization of the protein encoded by this gene and the EDR2 protein. [provided by RefSeq, Jul 2008]
Mouse(13619) polyhomeotic-like 1 (Drosophila)
Rat(312690) polyhomeotic homolog 1 (Drosophila)
Zebrafish(403008) polyhomeotic homolog 1
chicken(418252) polyhomeotic homolog 1 (Drosophila)
Horse(100053465) polyhomeotic homolog 1 (Drosophila)
domestic cat(101097991) polyhomeotic homolog 1 (Drosophila)
dog(610167) polyhomeotic homolog 1 (Drosophila)
naked mole-rat(101705028) polyhomeotic homolog 1 (Drosophila)
domestic guinea pig(100728333) polyhomeotic homolog 1 (Drosophila)
cow(540021) polyhomeotic homolog 1 (Drosophila)
sheep(101104987) polyhomeotic homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004426 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007905 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007905 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007905 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004426 Rosetta Predictions human pricing
NM_001107886 Rosetta Predictions rat pricing
NM_001042623 Rosetta Predictions mouse pricing
NM_007905 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019712 predicted 2537
2 SASI_Hs01_00019713 predicted 2107
3 SASI_Hs01_00019714 predicted 234
4 SASI_Hs01_00019715 predicted 2397
5 SASI_Hs02_00337592 predicted 3030
6 SASI_Hs01_00019717 predicted 3157
7 SASI_Hs01_00019718 predicted 2896
8 SASI_Hs01_00019719 predicted 2972
9 SASI_Hs01_00019720 predicted 616
10 SASI_Hs02_00337593 predicted 2802
11 SASI_Hs01_00019716 predicted 2026
12 SASI_Hs01_00019721 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233245 predicted 2747
2 SASI_Rn02_00233246 predicted 2587
3 SASI_Rn02_00233247 predicted 733
4 SASI_Rn02_00233248 predicted 3036
5 SASI_Rn02_00233249 predicted 3096
6 SASI_Rn02_00233250 predicted 2809
7 SASI_Rn02_00233251 predicted 2759
8 SASI_Rn02_00233252 predicted 3142
9 SASI_Rn02_00233253 predicted 3131
10 SASI_Rn02_00233254 predicted 2950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042623 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290785 predicted 2841
2 SASI_Mm02_00290786 predicted 2915
3 SASI_Mm02_00290787 predicted 2048
4 SASI_Mm02_00290788 predicted 1842
5 SASI_Mm02_00290789 predicted 870
6 SASI_Mm02_00290790 predicted 2782
7 SASI_Mm02_00290791 predicted 263
8 SASI_Mm02_00290792 predicted 2872
9 SASI_Mm02_00290793 predicted 2434
10 SASI_Mm02_00290794 predicted 2501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053651 predicted 2996
2 SASI_Mm02_00312703 predicted 3073
3 SASI_Mm01_00053653 predicted 2202
4 SASI_Mm01_00053655 predicted 2000
5 SASI_Mm02_00312704 predicted 1030
6 SASI_Mm02_00312705 predicted 2936
7 SASI_Mm01_00053656 predicted 267
8 SASI_Mm02_00312706 predicted 3030
9 SASI_Mm01_00053658 predicted 2590
10 SASI_Mm01_00053659 predicted 2660
11 SASI_Mm01_00053650 predicted 368
12 SASI_Mm01_00053652 predicted 2249
13 SASI_Mm01_00053654 predicted 3115
14 SASI_Mm01_00053657 predicted 661
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004426
VALIDATED
PHC1 MISSION shRNA Bacterial Glycerol Stock
polyhomeotic homolog 1 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004426.2-3210s21c1
Sequence:CCGGCTCCACTGTCCAGGTTATAACCTCGAGGTTATAACCTGGACAGTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004426.2-3414s21c1
Sequence:CCGGCGTACCTTAATCCAATCTTTACTCGAGTAAAGATTGGATTAAGGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004426.2-2621s21c1
Sequence:CCGGCTTGCGCTAAGAGGTACAATGCTCGAGCATTGTACCTCTTAGCGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004426.1-2904s1c1
Sequence:CCGGCCTGGGCCTTTATCAGTAAGACTCGAGTCTTACTGATAAAGGCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004426.1-2402s1c1
Sequence:CCGGCCAGATTCTCACCCACATCATCTCGAGATGATGTGGGTGAGAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004426.1-2739s1c1
Sequence:CCGGGAGTTTCAAGAAGCCAACTATCTCGAGATAGTTGGCTTCTTGAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004426.1-3036s1c1
Sequence:CCGGGAGGAGGTGTACGAGTTTATTCTCGAGAATAAACTCGTACACCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004426.1-1686s1c1
Sequence:CCGGCCAATTCCCATCCAATCCAAACTCGAGTTTGGATTGGATGGGAATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004426
VALIDATED
PHC1 MISSION shRNA shRNA Plasmid DNA
polyhomeotic homolog 1 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004426.2-3210s21c1
Sequence:CCGGCTCCACTGTCCAGGTTATAACCTCGAGGTTATAACCTGGACAGTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004426.2-3414s21c1
Sequence:CCGGCGTACCTTAATCCAATCTTTACTCGAGTAAAGATTGGATTAAGGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004426.2-2621s21c1
Sequence:CCGGCTTGCGCTAAGAGGTACAATGCTCGAGCATTGTACCTCTTAGCGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004426.1-2904s1c1
Sequence:CCGGCCTGGGCCTTTATCAGTAAGACTCGAGTCTTACTGATAAAGGCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004426.1-2402s1c1
Sequence:CCGGCCAGATTCTCACCCACATCATCTCGAGATGATGTGGGTGAGAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004426.1-2739s1c1
Sequence:CCGGGAGTTTCAAGAAGCCAACTATCTCGAGATAGTTGGCTTCTTGAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004426.1-3036s1c1
Sequence:CCGGGAGGAGGTGTACGAGTTTATTCTCGAGAATAAACTCGTACACCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004426.1-1686s1c1
Sequence:CCGGCCAATTCCCATCCAATCCAAACTCGAGTTTGGATTGGATGGGAATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004426
VALIDATED
PHC1 MISSION shRNA Lentiviral Transduction Particles
polyhomeotic homolog 1 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004426.2-3210s21c1
Sequence:CCGGCTCCACTGTCCAGGTTATAACCTCGAGGTTATAACCTGGACAGTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004426.2-3414s21c1
Sequence:CCGGCGTACCTTAATCCAATCTTTACTCGAGTAAAGATTGGATTAAGGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004426.2-2621s21c1
Sequence:CCGGCTTGCGCTAAGAGGTACAATGCTCGAGCATTGTACCTCTTAGCGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004426.1-2904s1c1
Sequence:CCGGCCTGGGCCTTTATCAGTAAGACTCGAGTCTTACTGATAAAGGCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004426.1-2402s1c1
Sequence:CCGGCCAGATTCTCACCCACATCATCTCGAGATGATGTGGGTGAGAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004426.1-2739s1c1
Sequence:CCGGGAGTTTCAAGAAGCCAACTATCTCGAGATAGTTGGCTTCTTGAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004426.1-3036s1c1
Sequence:CCGGGAGGAGGTGTACGAGTTTATTCTCGAGAATAAACTCGTACACCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004426.1-1686s1c1
Sequence:CCGGCCAATTCCCATCCAATCCAAACTCGAGTTTGGATTGGATGGGAATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007905
VALIDATED
PHC1 MISSION shRNA Bacterial Glycerol Stock
polyhomeotic homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007905.2-3112s21c1
Sequence:CCGGGCCTGGCTGTTCAGGTTATAACTCGAGTTATAACCTGAACAGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007905.2-565s21c1
Sequence:CCGGAGCTCATCCTGATGCCTAATGCTCGAGCATTAGGCATCAGGATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007905.2-1136s21c1
Sequence:CCGGGCTTATTAGCTCAGCCACATACTCGAGTATGTGGCTGAGCTAATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007905.2-1513s21c1
Sequence:CCGGCACCTGAACCAACCTCTAAACCTCGAGGTTTAGAGGTTGGTTCAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007905.2-180s21c1
Sequence:CCGGCAACCTAATGCGGCTCAATATCTCGAGATATTGAGCCGCATTAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007905.1-3246s1c1
Sequence:CCGGCCTTCTCACTATTCACACCTACTCGAGTAGGTGTGAATAGTGAGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007905.1-161s1c1
Sequence:CCGGGCAACCTAATGCGGCTCAATACTCGAGTATTGAGCCGCATTAGGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007905.1-1118s1c1
Sequence:CCGGGCTTATTAGCTCAGCCACATACTCGAGTATGTGGCTGAGCTAATAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007905.1-2127s1c1
Sequence:CCGGCCTCCAAACAGTGATCTAGTACTCGAGTACTAGATCACTGTTTGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007905.1-2817s1c1
Sequence:CCGGCCAGAGTTACAGGGCATCAATCTCGAGATTGATGCCCTGTAACTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007905
VALIDATED
PHC1 MISSION shRNA shRNA Plasmid DNA
polyhomeotic homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007905.2-3112s21c1
Sequence:CCGGGCCTGGCTGTTCAGGTTATAACTCGAGTTATAACCTGAACAGCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007905.2-565s21c1
Sequence:CCGGAGCTCATCCTGATGCCTAATGCTCGAGCATTAGGCATCAGGATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007905.2-1136s21c1
Sequence:CCGGGCTTATTAGCTCAGCCACATACTCGAGTATGTGGCTGAGCTAATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007905.2-1513s21c1
Sequence:CCGGCACCTGAACCAACCTCTAAACCTCGAGGTTTAGAGGTTGGTTCAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007905.2-180s21c1
Sequence:CCGGCAACCTAATGCGGCTCAATATCTCGAGATATTGAGCCGCATTAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007905.1-3246s1c1
Sequence:CCGGCCTTCTCACTATTCACACCTACTCGAGTAGGTGTGAATAGTGAGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007905.1-161s1c1
Sequence:CCGGGCAACCTAATGCGGCTCAATACTCGAGTATTGAGCCGCATTAGGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007905.1-1118s1c1
Sequence:CCGGGCTTATTAGCTCAGCCACATACTCGAGTATGTGGCTGAGCTAATAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007905.1-2127s1c1
Sequence:CCGGCCTCCAAACAGTGATCTAGTACTCGAGTACTAGATCACTGTTTGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007905.1-2817s1c1
Sequence:CCGGCCAGAGTTACAGGGCATCAATCTCGAGATTGATGCCCTGTAACTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007905
VALIDATED
PHC1 MISSION shRNA Lentiviral Transduction Particles
polyhomeotic homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007905.2-3112s21c1
Sequence:CCGGGCCTGGCTGTTCAGGTTATAACTCGAGTTATAACCTGAACAGCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007905.2-565s21c1
Sequence:CCGGAGCTCATCCTGATGCCTAATGCTCGAGCATTAGGCATCAGGATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007905.2-1136s21c1
Sequence:CCGGGCTTATTAGCTCAGCCACATACTCGAGTATGTGGCTGAGCTAATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007905.2-1513s21c1
Sequence:CCGGCACCTGAACCAACCTCTAAACCTCGAGGTTTAGAGGTTGGTTCAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007905.2-180s21c1
Sequence:CCGGCAACCTAATGCGGCTCAATATCTCGAGATATTGAGCCGCATTAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007905.1-3246s1c1
Sequence:CCGGCCTTCTCACTATTCACACCTACTCGAGTAGGTGTGAATAGTGAGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007905.1-161s1c1
Sequence:CCGGGCAACCTAATGCGGCTCAATACTCGAGTATTGAGCCGCATTAGGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007905.1-1118s1c1
Sequence:CCGGGCTTATTAGCTCAGCCACATACTCGAGTATGTGGCTGAGCTAATAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007905.1-2127s1c1
Sequence:CCGGCCTCCAAACAGTGATCTAGTACTCGAGTACTAGATCACTGTTTGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007905.1-2817s1c1
Sequence:CCGGCCAGAGTTACAGGGCATCAATCTCGAGATTGATGCCCTGTAACTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)