EMAIL THIS PAGE TO A FRIEND

PHC2

polyhomeotic homolog 2 (Drosophila)

177 Gene Product Result for
Synonyms: EDR2 HPH2 PH2
Gene ID:
Human(1912) Summary: In Drosophila melanogaster, the 'Polycomb' group (PcG) of genes are part of a cellular memory system that is responsible for the stable inheritance of gene activity. PcG proteins form a large multimeric, chromatin-associated protein complex. The protein encoded by this gene has homology to the Drosophila PcG protein 'polyhomeotic' (Ph) and is known to heterodimerize with EDR1 and colocalize with BMI1 in interphase nuclei of human cells. The specific function in human cells has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(54383) polyhomeotic-like 2 (Drosophila)
Rat(313038) polyhomeotic homolog 2 (Drosophila)
chicken(100857390) polyhomeotic homolog 2 (Drosophila)
dog(487297) polyhomeotic homolog 2 (Drosophila)
domestic cat(101082329) polyhomeotic homolog 2 (Drosophila)
Horse(100070002) polyhomeotic homolog 2 (Drosophila)
cow(537511) polyhomeotic homolog 2 (Drosophila)
sheep(101109942) polyhomeotic homolog 2 (Drosophila)
domestic guinea pig(100732113) polyhomeotic homolog 2 (Drosophila)
naked mole-rat(101700417) polyhomeotic homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004427 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004427 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004427 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018774 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018774 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018774 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004427 Rosetta Predictions human pricing
NM_198040 Rosetta Predictions human pricing
NM_001013169 Rosetta Predictions rat pricing
NM_018774 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150775 predicted 1113
2 SASI_Hs01_00150776 predicted 1706
3 SASI_Hs01_00150777 predicted 1110
4 SASI_Hs02_00337594 predicted 1510
5 SASI_Hs01_00150778 predicted 960
6 SASI_Hs01_00150779 predicted 619
7 SASI_Hs01_00150780 predicted 703
8 SASI_Hs01_00150782 predicted 859
9 SASI_Hs01_00150783 predicted 973
10 SASI_Hs01_00150784 predicted 620
11 SASI_Hs01_00150781 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089299 predicted 2424
2 SASI_Hs01_00089300 predicted 3014
3 SASI_Hs01_00089301 predicted 2418
4 SASI_Hs02_00371599 predicted 2811
5 SASI_Hs01_00089302 predicted 2268
6 SASI_Hs01_00089303 predicted 1927
7 SASI_Hs01_00089304 predicted 2011
8 SASI_Hs01_00089306 predicted 2171
9 SASI_Hs01_00089307 predicted 2277
10 SASI_Hs01_00089308 predicted 1922
11 SASI_Hs01_00089305 predicted 2303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013169 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200913 predicted 1647
2 SASI_Rn02_00200914 predicted 2246
3 SASI_Rn02_00200915 predicted 2407
4 SASI_Rn02_00200916 predicted 1736
5 SASI_Rn02_00200917 predicted 2523
6 SASI_Rn02_00200918 predicted 2388
7 SASI_Rn02_00200919 predicted 1722
8 SASI_Rn02_00200920 predicted 1317
9 SASI_Rn02_00200921 predicted 2417
10 SASI_Rn02_00200922 predicted 2255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105642 predicted 1739
2 SASI_Mm01_00105643 predicted 2404
3 SASI_Mm01_00105644 predicted 1726
4 SASI_Mm01_00105645 predicted 2526
5 SASI_Mm01_00105646 predicted 1304
6 SASI_Mm01_00105647 predicted 505
7 SASI_Mm01_00105648 predicted 414
8 SASI_Mm01_00105649 predicted 1018
9 SASI_Mm01_00105650 predicted 2560
10 SASI_Mm01_00105651 predicted 1737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004427
VALIDATED
PHC2 MISSION shRNA Bacterial Glycerol Stock
polyhomeotic homolog 2 (Drosophila)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004427.2-1137s1c1
Sequence:CCGGCCCACCAAGTGGAATGTAGAACTCGAGTTCTACATTCCACTTGGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004427.2-677s1c1
Sequence:CCGGCCTCAAACTCAAGTGTGAGCTCTCGAGAGCTCACACTTGAGTTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004427.2-1591s1c1
Sequence:CCGGGCTTCCTCCAAAGTCCCAATACTCGAGTATTGGGACTTTGGAGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004427.2-979s1c1
Sequence:CCGGGCCGTTGCTCAGATAACTCAACTCGAGTTGAGTTATCTGAGCAACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004427.2-641s1c1
Sequence:CCGGGCCCTATCTGCAAGAATCCAACTCGAGTTGGATTCTTGCAGATAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004427.2-763s1c1
Sequence:CCGGCAAAGAGGTACAACGTGGGATCTCGAGATCCCACGTTGTACCTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004427.2-473s1c1
Sequence:CCGGGACGCATGTTATCGAAGGGTTCTCGAGAACCCTTCGATAACATGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004427.2-929s1c1
Sequence:CCGGCCTTTCGGTTACTGCTGCTTTCTCGAGAAAGCAGCAGTAACCGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004427.2-2353s1c1
Sequence:CCGGCCCACACTTCTTTGCCTATAACTCGAGTTATAGGCAAAGAAGTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004427.2-995s1c1
Sequence:CCGGCTCAAGCTATGAGGAACCCTTCTCGAGAAGGGTTCCTCATAGCTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004427.3-658s21c1
Sequence:CCGGCCTCAAACTCAAGTGTGAGCTCTCGAGAGCTCACACTTGAGTTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004427.3-1572s21c1
Sequence:CCGGGCTTCCTCCAAAGTCCCAATACTCGAGTATTGGGACTTTGGAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004427.3-976s21c1
Sequence:CCGGCTCAAGCTATGAGGAACCCTTCTCGAGAAGGGTTCCTCATAGCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292442    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004427.3-2334s21c1
Sequence:CCGGCCCACACTTCTTTGCCTATAACTCGAGTTATAGGCAAAGAAGTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004427.3-960s21c1
Sequence:CCGGGCCGTTGCTCAGATAACTCAACTCGAGTTGAGTTATCTGAGCAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004427
VALIDATED
PHC2 MISSION shRNA shRNA Plasmid DNA
polyhomeotic homolog 2 (Drosophila)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004427.2-1137s1c1
Sequence:CCGGCCCACCAAGTGGAATGTAGAACTCGAGTTCTACATTCCACTTGGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004427.2-677s1c1
Sequence:CCGGCCTCAAACTCAAGTGTGAGCTCTCGAGAGCTCACACTTGAGTTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004427.2-1591s1c1
Sequence:CCGGGCTTCCTCCAAAGTCCCAATACTCGAGTATTGGGACTTTGGAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004427.2-979s1c1
Sequence:CCGGGCCGTTGCTCAGATAACTCAACTCGAGTTGAGTTATCTGAGCAACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004427.2-641s1c1
Sequence:CCGGGCCCTATCTGCAAGAATCCAACTCGAGTTGGATTCTTGCAGATAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004427.2-763s1c1
Sequence:CCGGCAAAGAGGTACAACGTGGGATCTCGAGATCCCACGTTGTACCTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004427.2-473s1c1
Sequence:CCGGGACGCATGTTATCGAAGGGTTCTCGAGAACCCTTCGATAACATGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004427.2-929s1c1
Sequence:CCGGCCTTTCGGTTACTGCTGCTTTCTCGAGAAAGCAGCAGTAACCGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004427.2-2353s1c1
Sequence:CCGGCCCACACTTCTTTGCCTATAACTCGAGTTATAGGCAAAGAAGTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004427.2-995s1c1
Sequence:CCGGCTCAAGCTATGAGGAACCCTTCTCGAGAAGGGTTCCTCATAGCTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004427.3-658s21c1
Sequence:CCGGCCTCAAACTCAAGTGTGAGCTCTCGAGAGCTCACACTTGAGTTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004427.3-1572s21c1
Sequence:CCGGGCTTCCTCCAAAGTCCCAATACTCGAGTATTGGGACTTTGGAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004427.3-976s21c1
Sequence:CCGGCTCAAGCTATGAGGAACCCTTCTCGAGAAGGGTTCCTCATAGCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292442    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004427.3-2334s21c1
Sequence:CCGGCCCACACTTCTTTGCCTATAACTCGAGTTATAGGCAAAGAAGTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004427.3-960s21c1
Sequence:CCGGGCCGTTGCTCAGATAACTCAACTCGAGTTGAGTTATCTGAGCAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004427
VALIDATED
PHC2 MISSION shRNA Lentiviral Transduction Particles
polyhomeotic homolog 2 (Drosophila)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004427.2-1137s1c1
Sequence:CCGGCCCACCAAGTGGAATGTAGAACTCGAGTTCTACATTCCACTTGGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004427.2-677s1c1
Sequence:CCGGCCTCAAACTCAAGTGTGAGCTCTCGAGAGCTCACACTTGAGTTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004427.2-1591s1c1
Sequence:CCGGGCTTCCTCCAAAGTCCCAATACTCGAGTATTGGGACTTTGGAGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004427.2-979s1c1
Sequence:CCGGGCCGTTGCTCAGATAACTCAACTCGAGTTGAGTTATCTGAGCAACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004427.2-641s1c1
Sequence:CCGGGCCCTATCTGCAAGAATCCAACTCGAGTTGGATTCTTGCAGATAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004427.2-763s1c1
Sequence:CCGGCAAAGAGGTACAACGTGGGATCTCGAGATCCCACGTTGTACCTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004427.2-473s1c1
Sequence:CCGGGACGCATGTTATCGAAGGGTTCTCGAGAACCCTTCGATAACATGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004427.2-929s1c1
Sequence:CCGGCCTTTCGGTTACTGCTGCTTTCTCGAGAAAGCAGCAGTAACCGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004427.2-2353s1c1
Sequence:CCGGCCCACACTTCTTTGCCTATAACTCGAGTTATAGGCAAAGAAGTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004427.2-995s1c1
Sequence:CCGGCTCAAGCTATGAGGAACCCTTCTCGAGAAGGGTTCCTCATAGCTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004427.3-658s21c1
Sequence:CCGGCCTCAAACTCAAGTGTGAGCTCTCGAGAGCTCACACTTGAGTTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004427.3-1572s21c1
Sequence:CCGGGCTTCCTCCAAAGTCCCAATACTCGAGTATTGGGACTTTGGAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004427.3-976s21c1
Sequence:CCGGCTCAAGCTATGAGGAACCCTTCTCGAGAAGGGTTCCTCATAGCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292442    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004427.3-2334s21c1
Sequence:CCGGCCCACACTTCTTTGCCTATAACTCGAGTTATAGGCAAAGAAGTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004427.3-960s21c1
Sequence:CCGGGCCGTTGCTCAGATAACTCAACTCGAGTTGAGTTATCTGAGCAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018774
VALIDATED
PHC2 MISSION shRNA Bacterial Glycerol Stock
polyhomeotic homolog 2 (Drosophila)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000108965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018774.1-3377s1c1
Sequence:CCGGCCTCCAGATAGCAAGAGGTTTCTCGAGAAACCTCTTGCTATCTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018774.1-1733s1c1
Sequence:CCGGCCAAATCCTGACGCATGTTATCTCGAGATAACATGCGTCAGGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018774.1-2025s1c1
Sequence:CCGGGCTTGTGCAAAGAGGTATAATCTCGAGATTATACCTCTTTGCACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018774.1-1911s1c1
Sequence:CCGGCCCTACCTGCAAGAATCCAAACTCGAGTTTGGATTCTTGCAGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018774
VALIDATED
PHC2 MISSION shRNA shRNA Plasmid DNA
polyhomeotic homolog 2 (Drosophila)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000108965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018774.1-3377s1c1
Sequence:CCGGCCTCCAGATAGCAAGAGGTTTCTCGAGAAACCTCTTGCTATCTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018774.1-1733s1c1
Sequence:CCGGCCAAATCCTGACGCATGTTATCTCGAGATAACATGCGTCAGGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018774.1-2025s1c1
Sequence:CCGGGCTTGTGCAAAGAGGTATAATCTCGAGATTATACCTCTTTGCACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018774.1-1911s1c1
Sequence:CCGGCCCTACCTGCAAGAATCCAAACTCGAGTTTGGATTCTTGCAGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018774
VALIDATED
PHC2 MISSION shRNA Lentiviral Transduction Particles
polyhomeotic homolog 2 (Drosophila)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000108965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018774.1-3377s1c1
Sequence:CCGGCCTCCAGATAGCAAGAGGTTTCTCGAGAAACCTCTTGCTATCTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018774.1-1733s1c1
Sequence:CCGGCCAAATCCTGACGCATGTTATCTCGAGATAACATGCGTCAGGATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_018774.1-2025s1c1
Sequence:CCGGGCTTGTGCAAAGAGGTATAATCTCGAGATTATACCTCTTTGCACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018774.1-1911s1c1
Sequence:CCGGCCCTACCTGCAAGAATCCAAACTCGAGTTTGGATTCTTGCAGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)