EMAIL THIS PAGE TO A FRIEND

PHC3

polyhomeotic homolog 3 (Drosophila)

58 Gene Product Result for
Synonyms: EDR3 HPH3
Gene ID:
Mouse(241915) polyhomeotic-like 3 (Drosophila)
Rat(310258) polyhomeotic homolog 3 (Drosophila)
Zebrafish(558094) polyhomeotic homolog 3 (Drosophila)
dog(488158) polyhomeotic homolog 3 (Drosophila)
domestic cat(101087260) polyhomeotic homolog 3 (Drosophila)
chicken(429159) polyhomeotic homolog 3 (Drosophila)
naked mole-rat(101723988) polyhomeotic homolog 3 (Drosophila)
Domestic Rabbit(100346297) polyhomeotic homolog 3 (Drosophila)
domestic guinea pig(100731706) polyhomeotic homolog 3 (Drosophila)
cow(534916) polyhomeotic homolog 3 (Drosophila)
sheep(101118840) polyhomeotic homolog 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024947 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024947 Rosetta Predictions human pricing
NM_001107662 Rosetta Predictions rat pricing
NM_153421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055293 predicted 2531
2 SASI_Hs01_00055294 predicted 2613
3 SASI_Hs01_00055295 predicted 1864
4 SASI_Hs02_00357601 predicted 3080
5 SASI_Hs01_00055296 predicted 2814
6 SASI_Hs01_00055297 predicted 1383
7 SASI_Hs01_00055298 predicted 1279
8 SASI_Hs01_00055299 predicted 1156
9 SASI_Hs01_00055300 predicted 770
10 SASI_Hs02_00357602 predicted 658
11 SASI_Hs01_00055292 predicted 461
12 SASI_Hs01_00055301 predicted 2150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107662 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231035 predicted 811
2 SASI_Rn02_00231036 predicted 2383
3 SASI_Rn02_00231037 predicted 2468
4 SASI_Rn02_00231038 predicted 648
5 SASI_Rn02_00231039 predicted 1480
6 SASI_Rn02_00231040 predicted 1815
7 SASI_Rn02_00231041 predicted 2190
8 SASI_Rn02_00231042 predicted 1795
9 SASI_Rn02_00231043 predicted 2867
10 SASI_Rn02_00231044 predicted 2396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057631 predicted 946
2 SASI_Mm01_00057632 predicted 2520
3 SASI_Mm01_00057633 predicted 353
4 SASI_Mm01_00057634 predicted 2602
5 SASI_Mm01_00057635 predicted 403
6 SASI_Mm01_00057636 predicted 2753
7 SASI_Mm01_00057637 predicted 781
8 SASI_Mm01_00057638 predicted 490
9 SASI_Mm01_00057639 predicted 2742
10 SASI_Mm01_00057640 predicted 2330
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153421
VALIDATED
PHC3 MISSION shRNA Bacterial Glycerol Stock
polyhomeotic homolog 3 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153421.2-1767s21c1
Sequence:CCGGCACAGACTGTTGCGGTAAATCCTCGAGGATTTACCGCAACAGTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153421.2-925s21c1
Sequence:CCGGATCAAGCATCCACCAGTTAATCTCGAGATTAACTGGTGGATGCTTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153421.2-2547s21c1
Sequence:CCGGGGAATCGTAAGCCTGATAATCCTCGAGGATTATCAGGCTTACGATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153421.2-206s21c1
Sequence:CCGGCGACATGCTGTTCAGGTAATTCTCGAGAATTACCTGAACAGCATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153421.2-3206s21c1
Sequence:CCGGGTGAACATCGGTGACATTAATCTCGAGATTAATGTCACCGATGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153421.1-3227s1c1
Sequence:CCGGGCTACACTGAAAGACTTGTTACTCGAGTAACAAGTCTTTCAGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153421.1-403s1c1
Sequence:CCGGGCAGTGTTACACAACAGTCAACTCGAGTTGACTGTTGTGTAACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153421.1-2142s1c1
Sequence:CCGGGCTATTGTGAAACCACAGATTCTCGAGAATCTGTGGTTTCACAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153421.1-960s1c1
Sequence:CCGGCCTCATTCTCTAATCAAACATCTCGAGATGTTTGATTAGAGAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153421.1-1806s1c1
Sequence:CCGGCCAGTGGTTTATCAAGTAGAACTCGAGTTCTACTTGATAAACCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153421
VALIDATED
PHC3 MISSION shRNA shRNA Plasmid DNA
polyhomeotic homolog 3 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153421.2-1767s21c1
Sequence:CCGGCACAGACTGTTGCGGTAAATCCTCGAGGATTTACCGCAACAGTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153421.2-925s21c1
Sequence:CCGGATCAAGCATCCACCAGTTAATCTCGAGATTAACTGGTGGATGCTTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153421.2-2547s21c1
Sequence:CCGGGGAATCGTAAGCCTGATAATCCTCGAGGATTATCAGGCTTACGATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153421.2-206s21c1
Sequence:CCGGCGACATGCTGTTCAGGTAATTCTCGAGAATTACCTGAACAGCATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153421.2-3206s21c1
Sequence:CCGGGTGAACATCGGTGACATTAATCTCGAGATTAATGTCACCGATGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153421.1-3227s1c1
Sequence:CCGGGCTACACTGAAAGACTTGTTACTCGAGTAACAAGTCTTTCAGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153421.1-403s1c1
Sequence:CCGGGCAGTGTTACACAACAGTCAACTCGAGTTGACTGTTGTGTAACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153421.1-2142s1c1
Sequence:CCGGGCTATTGTGAAACCACAGATTCTCGAGAATCTGTGGTTTCACAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153421.1-960s1c1
Sequence:CCGGCCTCATTCTCTAATCAAACATCTCGAGATGTTTGATTAGAGAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153421.1-1806s1c1
Sequence:CCGGCCAGTGGTTTATCAAGTAGAACTCGAGTTCTACTTGATAAACCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153421
VALIDATED
PHC3 MISSION shRNA Lentiviral Transduction Particles
polyhomeotic homolog 3 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153421.2-1767s21c1
Sequence:CCGGCACAGACTGTTGCGGTAAATCCTCGAGGATTTACCGCAACAGTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153421.2-925s21c1
Sequence:CCGGATCAAGCATCCACCAGTTAATCTCGAGATTAACTGGTGGATGCTTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153421.2-2547s21c1
Sequence:CCGGGGAATCGTAAGCCTGATAATCCTCGAGGATTATCAGGCTTACGATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153421.2-206s21c1
Sequence:CCGGCGACATGCTGTTCAGGTAATTCTCGAGAATTACCTGAACAGCATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153421.2-3206s21c1
Sequence:CCGGGTGAACATCGGTGACATTAATCTCGAGATTAATGTCACCGATGTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153421.1-3227s1c1
Sequence:CCGGGCTACACTGAAAGACTTGTTACTCGAGTAACAAGTCTTTCAGTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153421.1-403s1c1
Sequence:CCGGGCAGTGTTACACAACAGTCAACTCGAGTTGACTGTTGTGTAACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153421.1-2142s1c1
Sequence:CCGGGCTATTGTGAAACCACAGATTCTCGAGAATCTGTGGTTTCACAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153421.1-960s1c1
Sequence:CCGGCCTCATTCTCTAATCAAACATCTCGAGATGTTTGATTAGAGAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153421.1-1806s1c1
Sequence:CCGGCCAGTGGTTTATCAAGTAGAACTCGAGTTCTACTTGATAAACCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024947
VALIDATED
PHC3 MISSION shRNA Bacterial Glycerol Stock
polyhomeotic homolog 3 (Drosophila)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024947.3-200s21c1
Sequence:CCGGCGACATGCTGTACAGGTAATTCTCGAGAATTACCTGTACAGCATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024947.2-1224s1c1
Sequence:CCGGCAAGTCAGTCTCCTACTATAACTCGAGTTATAGTAGGAGACTGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024947.2-1557s1c1
Sequence:CCGGCCTTGCAGTCTATGCAGTCTTCTCGAGAAGACTGCATAGACTGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024947.2-375s1c1
Sequence:CCGGCCAGTGGAAGACCATCTACATCTCGAGATGTAGATGGTCTTCCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_024947.2-2102s1c1
Sequence:CCGGCCACAGATCCTAACCCATGTTCTCGAGAACATGGGTTAGGATCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024947.2-281s1c1
Sequence:CCGGCAACAGCACTTGATGCTGCATCTCGAGATGCAGCATCAAGTGCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024947.2-2808s1c1
Sequence:CCGGGCCAGGATATCGCAGATGAATCTCGAGATTCATCTGCGATATCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143103    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024947.2-3096s1c1
Sequence:CCGGCTGACATTTCTTCTACAGGTACTCGAGTACCTGTAGAAGAAATGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_024947.2-456s1c1
Sequence:CCGGGCAGTATTACCCAACAGACTACTCGAGTAGTCTGTTGGGTAATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140991    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024947.2-3073s1c1
Sequence:CCGGCATTGGGATCTCCACATCAAACTCGAGTTTGATGTGGAGATCCCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024947.2-2960s1c1
Sequence:CCGGCAGGAACATGAAGCCTTGATACTCGAGTATCAAGGCTTCATGTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024947
VALIDATED
PHC3 MISSION shRNA shRNA Plasmid DNA
polyhomeotic homolog 3 (Drosophila)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024947.3-200s21c1
Sequence:CCGGCGACATGCTGTACAGGTAATTCTCGAGAATTACCTGTACAGCATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024947.2-1224s1c1
Sequence:CCGGCAAGTCAGTCTCCTACTATAACTCGAGTTATAGTAGGAGACTGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024947.2-1557s1c1
Sequence:CCGGCCTTGCAGTCTATGCAGTCTTCTCGAGAAGACTGCATAGACTGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024947.2-375s1c1
Sequence:CCGGCCAGTGGAAGACCATCTACATCTCGAGATGTAGATGGTCTTCCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_024947.2-2102s1c1
Sequence:CCGGCCACAGATCCTAACCCATGTTCTCGAGAACATGGGTTAGGATCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024947.2-281s1c1
Sequence:CCGGCAACAGCACTTGATGCTGCATCTCGAGATGCAGCATCAAGTGCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024947.2-2808s1c1
Sequence:CCGGGCCAGGATATCGCAGATGAATCTCGAGATTCATCTGCGATATCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143103    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024947.2-3096s1c1
Sequence:CCGGCTGACATTTCTTCTACAGGTACTCGAGTACCTGTAGAAGAAATGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_024947.2-456s1c1
Sequence:CCGGGCAGTATTACCCAACAGACTACTCGAGTAGTCTGTTGGGTAATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140991    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024947.2-3073s1c1
Sequence:CCGGCATTGGGATCTCCACATCAAACTCGAGTTTGATGTGGAGATCCCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024947.2-2960s1c1
Sequence:CCGGCAGGAACATGAAGCCTTGATACTCGAGTATCAAGGCTTCATGTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024947
VALIDATED
PHC3 MISSION shRNA Lentiviral Transduction Particles
polyhomeotic homolog 3 (Drosophila)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024947.3-200s21c1
Sequence:CCGGCGACATGCTGTACAGGTAATTCTCGAGAATTACCTGTACAGCATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024947.2-1224s1c1
Sequence:CCGGCAAGTCAGTCTCCTACTATAACTCGAGTTATAGTAGGAGACTGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024947.2-1557s1c1
Sequence:CCGGCCTTGCAGTCTATGCAGTCTTCTCGAGAAGACTGCATAGACTGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024947.2-375s1c1
Sequence:CCGGCCAGTGGAAGACCATCTACATCTCGAGATGTAGATGGTCTTCCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_024947.2-2102s1c1
Sequence:CCGGCCACAGATCCTAACCCATGTTCTCGAGAACATGGGTTAGGATCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024947.2-281s1c1
Sequence:CCGGCAACAGCACTTGATGCTGCATCTCGAGATGCAGCATCAAGTGCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024947.2-2808s1c1
Sequence:CCGGGCCAGGATATCGCAGATGAATCTCGAGATTCATCTGCGATATCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143103    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024947.2-3096s1c1
Sequence:CCGGCTGACATTTCTTCTACAGGTACTCGAGTACCTGTAGAAGAAATGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_024947.2-456s1c1
Sequence:CCGGGCAGTATTACCCAACAGACTACTCGAGTAGTCTGTTGGGTAATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140991    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024947.2-3073s1c1
Sequence:CCGGCATTGGGATCTCCACATCAAACTCGAGTTTGATGTGGAGATCCCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024947.2-2960s1c1
Sequence:CCGGCAGGAACATGAAGCCTTGATACTCGAGTATCAAGGCTTCATGTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)