EMAIL THIS PAGE TO A FRIEND

PHEX

phosphate regulating endopeptidase homolog, X-linked

70 Gene Product Result for
Synonyms: HPDR HPDR1 HYP HYP1 LXHR PEX XLH
UniProtKB ID: P78562, O00678, Q13646, Q2M325, Q93032, Q99827
Gene ID:
Human(5251) Summary: The protein encoded by this gene is a transmembrane endopeptidase that belongs to the type II integral membrane zinc-dependent endopeptidase family. The protein is thought to be involved in bone and dentin mineralization and renal phosphate reabsorption. Mutations in this gene cause X-linked hypophosphatemic rickets. [provided by RefSeq, Jul 2008]
Mouse(18675) phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)
Rat(25512) phosphate regulating endopeptidase homolog, X-linked
cow(536029) phosphate regulating endopeptidase homolog, X-linked
sheep(101112286) phosphate regulating endopeptidase homolog, X-linked
domestic guinea pig(100714464) phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)
Zebrafish(386969) phosphate regulating gene with homologues to endopeptidases on the X chromosome
chicken(395777) phosphate regulating endopeptidase homolog, X-linked
dog(480862) phosphate regulating endopeptidase homolog, X-linked
Horse(100051921) phosphate regulating endopeptidase homolog, X-linked
domestic cat(101084775) phosphate regulating endopeptidase homolog, X-linked
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011077 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011077 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011077 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000444 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057011 MISSION® esiRNA esiRNA human PHEX (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000444 Rosetta Predictions human pricing
NM_013004 Rosetta Predictions rat pricing
NM_011077 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081769 predicted 1503
2 SASI_Hs01_00081770 predicted 2344
3 SASI_Hs01_00081771 predicted 428
4 SASI_Hs01_00081772 predicted 258
5 SASI_Hs01_00081773 predicted 272
6 SASI_Hs01_00081774 predicted 2528
7 SASI_Hs01_00081775 predicted 671
8 SASI_Hs01_00081776 predicted 1160
9 SASI_Hs01_00081777 predicted 773
10 SASI_Hs01_00081778 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048525 predicted 1637
2 SASI_Rn01_00048526 predicted 1118
3 SASI_Rn01_00048529 predicted 1295
4 SASI_Rn01_00048530 predicted 610
5 SASI_Rn02_00260662 predicted 2507
6 SASI_Rn01_00048532 predicted 2333
7 SASI_Rn01_00048533 predicted 1205
8 SASI_Rn01_00048534 predicted 1922
9 SASI_Rn02_00260663 predicted 902
10 SASI_Rn02_00260664 predicted 2621
11 SASI_Rn01_00048527 predicted 1998
12 SASI_Rn01_00048528 predicted 2029
13 SASI_Rn01_00048531 predicted 2084
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011077 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055886 predicted 1683
2 SASI_Mm01_00055887 predicted 940
3 SASI_Mm01_00055888 predicted 1346
4 SASI_Mm01_00055890 predicted 2597
5 SASI_Mm01_00055891 predicted 656
6 SASI_Mm01_00055892 predicted 2386
7 SASI_Mm01_00055893 predicted 1502
8 SASI_Mm02_00319848 predicted 589
9 SASI_Mm01_00055895 predicted 1115
10 SASI_Mm02_00319849 predicted 1471
11 SASI_Mm01_00055889 predicted 1452
12 SASI_Mm01_00055894 predicted 2398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011077
PHEX MISSION shRNA Bacterial Glycerol Stock
phosphate regulating endopeptidase homolog, X-linked
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011077.1-2656s1c1
Sequence:CCGGCCTCCACAATTTAGGGTCAATCTCGAGATTGACCCTAAATTGTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011077.1-2259s1c1
Sequence:CCGGCCATGAATTTACACATGGATTCTCGAGAATCCATGTGTAAATTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011077.1-1340s1c1
Sequence:CCGGCGGTGCTTAGACTGGAAATTACTCGAGTAATTTCCAGTCTAAGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011077.1-933s1c1
Sequence:CCGGCCTCTACTCATCCTGCATGAACTCGAGTTCATGCAGGATGAGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011077.1-1150s1c1
Sequence:CCGGCCTGATGACAAGGCATCCAATCTCGAGATTGGATGCCTTGTCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011077
PHEX MISSION shRNA shRNA Plasmid DNA
phosphate regulating endopeptidase homolog, X-linked
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011077.1-2656s1c1
Sequence:CCGGCCTCCACAATTTAGGGTCAATCTCGAGATTGACCCTAAATTGTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011077.1-2259s1c1
Sequence:CCGGCCATGAATTTACACATGGATTCTCGAGAATCCATGTGTAAATTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011077.1-1340s1c1
Sequence:CCGGCGGTGCTTAGACTGGAAATTACTCGAGTAATTTCCAGTCTAAGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011077.1-933s1c1
Sequence:CCGGCCTCTACTCATCCTGCATGAACTCGAGTTCATGCAGGATGAGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011077.1-1150s1c1
Sequence:CCGGCCTGATGACAAGGCATCCAATCTCGAGATTGGATGCCTTGTCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011077
PHEX MISSION shRNA Lentiviral Transduction Particles
phosphate regulating endopeptidase homolog, X-linked
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011077.1-2656s1c1
Sequence:CCGGCCTCCACAATTTAGGGTCAATCTCGAGATTGACCCTAAATTGTGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011077.1-2259s1c1
Sequence:CCGGCCATGAATTTACACATGGATTCTCGAGAATCCATGTGTAAATTCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011077.1-1340s1c1
Sequence:CCGGCGGTGCTTAGACTGGAAATTACTCGAGTAATTTCCAGTCTAAGCACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011077.1-933s1c1
Sequence:CCGGCCTCTACTCATCCTGCATGAACTCGAGTTCATGCAGGATGAGTAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011077.1-1150s1c1
Sequence:CCGGCCTGATGACAAGGCATCCAATCTCGAGATTGGATGCCTTGTCATCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000444
PHEX MISSION shRNA Bacterial Glycerol Stock
phosphate regulating endopeptidase homolog, X-linked
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000444.2-886s1c1
Sequence:CCGGCCCGAAGATATGCCAAGCTATCTCGAGATAGCTTGGCATATCTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000444.2-1447s1c1
Sequence:CCGGGCTGAGATAATGATTCCACATCTCGAGATGTGGAATCATTATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000444.2-2118s1c1
Sequence:CCGGCGTCCTACAAACTCGCAAGTACTCGAGTACTTGCGAGTTTGTAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000444.4-2060s21c1
Sequence:CCGGTAACCAGTATAGCAACTATTACTCGAGTAATAGTTGCTATACTGGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000444.4-776s21c1
Sequence:CCGGTGCAACGTTTCGTGGTCAATACTCGAGTATTGACCACGAAACGTTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000444.4-2352s21c1
Sequence:CCGGGTCAATGGTGCAATTAGTAACCTCGAGGTTACTAATTGCACCATTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000444.4-2612s21c1
Sequence:CCGGTCAAAGTTGTAGGGCTTATAACTCGAGTTATAAGCCCTACAACTTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000444
PHEX MISSION shRNA shRNA Plasmid DNA
phosphate regulating endopeptidase homolog, X-linked
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000444.2-886s1c1
Sequence:CCGGCCCGAAGATATGCCAAGCTATCTCGAGATAGCTTGGCATATCTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000444.2-1447s1c1
Sequence:CCGGGCTGAGATAATGATTCCACATCTCGAGATGTGGAATCATTATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000444.2-2118s1c1
Sequence:CCGGCGTCCTACAAACTCGCAAGTACTCGAGTACTTGCGAGTTTGTAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000444.4-2060s21c1
Sequence:CCGGTAACCAGTATAGCAACTATTACTCGAGTAATAGTTGCTATACTGGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000444.4-776s21c1
Sequence:CCGGTGCAACGTTTCGTGGTCAATACTCGAGTATTGACCACGAAACGTTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000444.4-2352s21c1
Sequence:CCGGGTCAATGGTGCAATTAGTAACCTCGAGGTTACTAATTGCACCATTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000444.4-2612s21c1
Sequence:CCGGTCAAAGTTGTAGGGCTTATAACTCGAGTTATAAGCCCTACAACTTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000444
PHEX MISSION shRNA Lentiviral Transduction Particles
phosphate regulating endopeptidase homolog, X-linked
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000444.2-886s1c1
Sequence:CCGGCCCGAAGATATGCCAAGCTATCTCGAGATAGCTTGGCATATCTTCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000444.2-1447s1c1
Sequence:CCGGGCTGAGATAATGATTCCACATCTCGAGATGTGGAATCATTATCTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000444.2-2118s1c1
Sequence:CCGGCGTCCTACAAACTCGCAAGTACTCGAGTACTTGCGAGTTTGTAGGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000444.4-2060s21c1
Sequence:CCGGTAACCAGTATAGCAACTATTACTCGAGTAATAGTTGCTATACTGGTTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000444.4-776s21c1
Sequence:CCGGTGCAACGTTTCGTGGTCAATACTCGAGTATTGACCACGAAACGTTGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000444.4-2352s21c1
Sequence:CCGGGTCAATGGTGCAATTAGTAACCTCGAGGTTACTAATTGCACCATTGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000444.4-2612s21c1
Sequence:CCGGTCAAAGTTGTAGGGCTTATAACTCGAGTTATAAGCCCTACAACTTTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)