EMAIL THIS PAGE TO A FRIEND

PHF10

PHD finger protein 10

56 Gene Product Result for
Synonyms: BAF45A XAP135
UniProtKB ID: Q8WUB8, Q2YDA3, Q53HG8, Q9BXD2, Q9NV26
Gene ID:
Human(55274) Summary: This gene contains a predicted ORF that encodes a protein with two zinc finger domains. The function of the encoded protein is not known. Sequence analysis suggests that multiple alternatively spliced transcript variants are derived from this gene but the full-length nature of only two of them is known. These two splice variants encode different isoforms. A pseudogene for this gene is located on Xq28. [provided by RefSeq, Jul 2008]
Mouse(72057) PHD finger protein 10
Rat(292404) PHD finger protein 10
cow(507648) PHD finger protein 10
sheep(101115467) PHD finger protein 10
naked mole-rat(101696862) PHD finger protein 10
domestic guinea pig(100734424) PHD finger protein 10
Zebrafish(393628) PHD finger protein 10
chicken(100857350) PHD finger protein 10
Horse(100049916) PHD finger protein 10
domestic cat(101083178) PHD finger protein 10
dog(475037) PHD finger protein 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018288 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024250 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024250 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024250 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117181 MISSION® esiRNA esiRNA human PHF10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018288 Rosetta Predictions human pricing
NM_133325 Rosetta Predictions human pricing
NM_001024747 Rosetta Predictions rat pricing
NM_024250 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070562 predicted 531
2 SASI_Hs01_00070563 predicted 994
3 SASI_Hs01_00070564 predicted 690
4 SASI_Hs01_00070565 predicted 779
5 SASI_Hs01_00070566 predicted 690
6 SASI_Hs01_00070567 predicted 844
7 SASI_Hs01_00070568 predicted 531
8 SASI_Hs01_00070569 predicted 759
9 SASI_Hs02_00351672 predicted 700
10 SASI_Hs01_00070571 predicted 610
11 SASI_Hs01_00070570 predicted 1060
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129476 predicted 522
2 SASI_Hs01_00129477 predicted 992
3 SASI_Hs01_00129478 predicted 686
4 SASI_Hs01_00129479 predicted 773
5 SASI_Hs01_00129480 predicted 684
6 SASI_Hs01_00129481 predicted 837
7 SASI_Hs01_00129482 predicted 527
8 SASI_Hs01_00129483 predicted 758
9 SASI_Hs02_00362994 predicted 694
10 SASI_Hs01_00129485 predicted 601
11 SASI_Hs01_00129484 predicted 1060
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090420 predicted 606
2 SASI_Rn01_00090421 predicted 557
3 SASI_Rn01_00090422 predicted 511
4 SASI_Rn02_00202622 predicted 663
5 SASI_Rn01_00090423 predicted 381
6 SASI_Rn01_00090424 predicted 355
7 SASI_Rn01_00090426 predicted 1227
8 SASI_Rn01_00090427 predicted 1382
9 SASI_Rn01_00090428 predicted 1205
10 SASI_Rn02_00202623 predicted 389
11 SASI_Rn01_00090425 predicted 587
12 SASI_Rn01_00090429 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092971 predicted 560
2 SASI_Mm01_00092972 predicted 398
3 SASI_Mm01_00092973 predicted 512
4 SASI_Mm01_00092974 predicted 359
5 SASI_Mm01_00092975 predicted 1226
6 SASI_Mm01_00092976 predicted 390
7 SASI_Mm01_00092977 predicted 1380
8 SASI_Mm01_00092978 predicted 1082
9 SASI_Mm01_00092979 predicted 714
10 SASI_Mm01_00092980 predicted 850
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018288
VALIDATED
PHF10 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 10
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018288.3-504s21c1
Sequence:CCGGGCAGTGATGAAGTGATTGATTCTCGAGAATCAATCACTTCATCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018288.2-382s1c1
Sequence:CCGGGCAGTGATGAAGTGATTGATTCTCGAGAATCAATCACTTCATCACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018288.3-656s21c1
Sequence:CCGGGCCAGTAAAGTGCCTGAGTATCTCGAGATACTCAGGCACTTTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018288.3-412s21c1
Sequence:CCGGGCGACGAGATTTGTCTCACAACTCGAGTTGTGAGACAAATCTCGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018288.2-534s1c1
Sequence:CCGGGCCAGTAAAGTGCCTGAGTATCTCGAGATACTCAGGCACTTTACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018288.2-879s1c1
Sequence:CCGGCGAGGTGATGAGAAACGGAAACTCGAGTTTCCGTTTCTCATCACCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018288.2-788s1c1
Sequence:CCGGGCCATTAAACACAGCCCTGTACTCGAGTACAGGGCTGTGTTTAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018288.2-290s1c1
Sequence:CCGGGCGACGAGATTTGTCTCACAACTCGAGTTGTGAGACAAATCTCGTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018288.3-544s21c1
Sequence:CCGGAGCCAAACATGCTGAGTATTCCTCGAGGAATACTCAGCATGTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018288.3-898s21c1
Sequence:CCGGGCTGCGGTATCTGCCATTAAACTCGAGTTTAATGGCAGATACCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018288.3-592s21c1
Sequence:CCGGACGAATTACAGACCATTATAACTCGAGTTATAATGGTCTGTAATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018288.3-1001s21c1
Sequence:CCGGCGAGGTGATGAGAAACGGAAACTCGAGTTTCCGTTTCTCATCACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018288.3-856s21c1
Sequence:CCGGCGGACAGTTCCAGGAATATTACTCGAGTAATATTCCTGGAACTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018288.3-736s21c1
Sequence:CCGGGGAAGAAAGAAGAGCTTATTTCTCGAGAAATAAGCTCTTCTTTCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018288
VALIDATED
PHF10 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 10
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018288.3-504s21c1
Sequence:CCGGGCAGTGATGAAGTGATTGATTCTCGAGAATCAATCACTTCATCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018288.2-382s1c1
Sequence:CCGGGCAGTGATGAAGTGATTGATTCTCGAGAATCAATCACTTCATCACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018288.3-656s21c1
Sequence:CCGGGCCAGTAAAGTGCCTGAGTATCTCGAGATACTCAGGCACTTTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018288.3-412s21c1
Sequence:CCGGGCGACGAGATTTGTCTCACAACTCGAGTTGTGAGACAAATCTCGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018288.2-534s1c1
Sequence:CCGGGCCAGTAAAGTGCCTGAGTATCTCGAGATACTCAGGCACTTTACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018288.2-879s1c1
Sequence:CCGGCGAGGTGATGAGAAACGGAAACTCGAGTTTCCGTTTCTCATCACCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018288.2-788s1c1
Sequence:CCGGGCCATTAAACACAGCCCTGTACTCGAGTACAGGGCTGTGTTTAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018288.2-290s1c1
Sequence:CCGGGCGACGAGATTTGTCTCACAACTCGAGTTGTGAGACAAATCTCGTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018288.3-544s21c1
Sequence:CCGGAGCCAAACATGCTGAGTATTCCTCGAGGAATACTCAGCATGTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018288.3-898s21c1
Sequence:CCGGGCTGCGGTATCTGCCATTAAACTCGAGTTTAATGGCAGATACCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018288.3-592s21c1
Sequence:CCGGACGAATTACAGACCATTATAACTCGAGTTATAATGGTCTGTAATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018288.3-1001s21c1
Sequence:CCGGCGAGGTGATGAGAAACGGAAACTCGAGTTTCCGTTTCTCATCACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018288.3-856s21c1
Sequence:CCGGCGGACAGTTCCAGGAATATTACTCGAGTAATATTCCTGGAACTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018288.3-736s21c1
Sequence:CCGGGGAAGAAAGAAGAGCTTATTTCTCGAGAAATAAGCTCTTCTTTCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018288
VALIDATED
PHF10 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 10
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018288.3-504s21c1
Sequence:CCGGGCAGTGATGAAGTGATTGATTCTCGAGAATCAATCACTTCATCACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018288.2-382s1c1
Sequence:CCGGGCAGTGATGAAGTGATTGATTCTCGAGAATCAATCACTTCATCACTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018288.3-656s21c1
Sequence:CCGGGCCAGTAAAGTGCCTGAGTATCTCGAGATACTCAGGCACTTTACTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018288.3-412s21c1
Sequence:CCGGGCGACGAGATTTGTCTCACAACTCGAGTTGTGAGACAAATCTCGTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018288.2-534s1c1
Sequence:CCGGGCCAGTAAAGTGCCTGAGTATCTCGAGATACTCAGGCACTTTACTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018288.2-879s1c1
Sequence:CCGGCGAGGTGATGAGAAACGGAAACTCGAGTTTCCGTTTCTCATCACCTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018288.2-788s1c1
Sequence:CCGGGCCATTAAACACAGCCCTGTACTCGAGTACAGGGCTGTGTTTAATGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018288.2-290s1c1
Sequence:CCGGGCGACGAGATTTGTCTCACAACTCGAGTTGTGAGACAAATCTCGTCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018288.3-544s21c1
Sequence:CCGGAGCCAAACATGCTGAGTATTCCTCGAGGAATACTCAGCATGTTTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018288.3-898s21c1
Sequence:CCGGGCTGCGGTATCTGCCATTAAACTCGAGTTTAATGGCAGATACCGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018288.3-592s21c1
Sequence:CCGGACGAATTACAGACCATTATAACTCGAGTTATAATGGTCTGTAATTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018288.3-1001s21c1
Sequence:CCGGCGAGGTGATGAGAAACGGAAACTCGAGTTTCCGTTTCTCATCACCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018288.3-856s21c1
Sequence:CCGGCGGACAGTTCCAGGAATATTACTCGAGTAATATTCCTGGAACTGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018288.3-736s21c1
Sequence:CCGGGGAAGAAAGAAGAGCTTATTTCTCGAGAAATAAGCTCTTCTTTCTTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024250
VALIDATED
PHF10 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 10
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024250.3-376s1c1
Sequence:CCGGGCGACGAGATTTATATCACAACTCGAGTTGTGATATAAATCTCGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024250.3-1169s1c1
Sequence:CCGGCCAAATGCTCTATGTGGAATTCTCGAGAATTCCACATAGAGCATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024250.3-409s1c1
Sequence:CCGGCCTGAGAGAATTAAACGTCATCTCGAGATGACGTTTAATTCTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024250.3-1267s1c1
Sequence:CCGGCCACCCTTCTTGCTTGGATATCTCGAGATATCCAAGCAAGAAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024250.3-506s1c1
Sequence:CCGGCCAGCTAAACACGCTGAATATCTCGAGATATTCAGCGTGTTTAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024250.3-1169s21c1
Sequence:CCGGCCAAATGCTCTATGTGGAATTCTCGAGAATTCCACATAGAGCATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024250.3-409s21c1
Sequence:CCGGCCTGAGAGAATTAAACGTCATCTCGAGATGACGTTTAATTCTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024250.3-1267s21c1
Sequence:CCGGCCACCCTTCTTGCTTGGATATCTCGAGATATCCAAGCAAGAAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024250.3-376s21c1
Sequence:CCGGGCGACGAGATTTATATCACAACTCGAGTTGTGATATAAATCTCGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024250
VALIDATED
PHF10 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 10
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024250.3-376s1c1
Sequence:CCGGGCGACGAGATTTATATCACAACTCGAGTTGTGATATAAATCTCGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024250.3-1169s1c1
Sequence:CCGGCCAAATGCTCTATGTGGAATTCTCGAGAATTCCACATAGAGCATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024250.3-409s1c1
Sequence:CCGGCCTGAGAGAATTAAACGTCATCTCGAGATGACGTTTAATTCTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024250.3-1267s1c1
Sequence:CCGGCCACCCTTCTTGCTTGGATATCTCGAGATATCCAAGCAAGAAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024250.3-506s1c1
Sequence:CCGGCCAGCTAAACACGCTGAATATCTCGAGATATTCAGCGTGTTTAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024250.3-1169s21c1
Sequence:CCGGCCAAATGCTCTATGTGGAATTCTCGAGAATTCCACATAGAGCATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024250.3-409s21c1
Sequence:CCGGCCTGAGAGAATTAAACGTCATCTCGAGATGACGTTTAATTCTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024250.3-1267s21c1
Sequence:CCGGCCACCCTTCTTGCTTGGATATCTCGAGATATCCAAGCAAGAAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024250.3-376s21c1
Sequence:CCGGGCGACGAGATTTATATCACAACTCGAGTTGTGATATAAATCTCGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024250
VALIDATED
PHF10 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 10
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024250.3-376s1c1
Sequence:CCGGGCGACGAGATTTATATCACAACTCGAGTTGTGATATAAATCTCGTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024250.3-1169s1c1
Sequence:CCGGCCAAATGCTCTATGTGGAATTCTCGAGAATTCCACATAGAGCATTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024250.3-409s1c1
Sequence:CCGGCCTGAGAGAATTAAACGTCATCTCGAGATGACGTTTAATTCTCTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024250.3-1267s1c1
Sequence:CCGGCCACCCTTCTTGCTTGGATATCTCGAGATATCCAAGCAAGAAGGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024250.3-506s1c1
Sequence:CCGGCCAGCTAAACACGCTGAATATCTCGAGATATTCAGCGTGTTTAGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024250.3-1169s21c1
Sequence:CCGGCCAAATGCTCTATGTGGAATTCTCGAGAATTCCACATAGAGCATTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024250.3-409s21c1
Sequence:CCGGCCTGAGAGAATTAAACGTCATCTCGAGATGACGTTTAATTCTCTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024250.3-1267s21c1
Sequence:CCGGCCACCCTTCTTGCTTGGATATCTCGAGATATCCAAGCAAGAAGGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024250.3-376s21c1
Sequence:CCGGGCGACGAGATTTATATCACAACTCGAGTTGTGATATAAATCTCGTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)