EMAIL THIS PAGE TO A FRIEND

PHF11

PHD finger protein 11

52 Gene Product Result for
Synonyms: APY BCAP IGEL IGER IGHER NY-REN-34 NYREN34
UniProtKB ID: Q9UIL8, Q5W0A4, Q5W0A6, Q9Y5A2
Gene ID:
Rat(361051) PHD finger protein 11
Zebrafish(569187) PHD finger protein 11
dog(608082) PHD finger protein 11
domestic cat(101100105) PHD finger protein 11
chicken(418867) PHD finger protein 11
domestic guinea pig(101788224) PHD finger protein 11
naked mole-rat(101725501) PHD finger protein 11
cow(513331) PHD finger protein 11
sheep(101116325) PHD finger protein 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040444 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016119 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016119 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016119 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081361 MISSION® esiRNA esiRNA human PHF11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040443 Rosetta Predictions human pricing
NM_001040444 Rosetta Predictions human pricing
NM_001024272 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017984 predicted 761
2 SASI_Hs01_00017985 predicted 893
3 SASI_Hs01_00017986 predicted 921
4 SASI_Hs01_00017987 predicted 714
5 SASI_Hs01_00017988 predicted 1003
6 SASI_Hs02_00308982 predicted 965
7 SASI_Hs01_00017990 predicted 1051
8 SASI_Hs01_00017991 predicted 1109
9 SASI_Hs01_00017992 predicted 1080
10 SASI_Hs01_00017993 predicted 650
11 SASI_Hs01_00017989 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047035 predicted 584
2 SASI_Hs01_00047036 predicted 713
3 SASI_Hs01_00047037 predicted 744
4 SASI_Hs01_00047038 predicted 538
5 SASI_Hs01_00047039 predicted 826
6 SASI_Hs02_00308983 predicted 782
7 SASI_Hs01_00047041 predicted 869
8 SASI_Hs01_00047042 predicted 932
9 SASI_Hs01_00047043 predicted 895
10 SASI_Hs01_00047044 predicted 469
11 SASI_Hs01_00047040 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024272 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202448 predicted 391
2 SASI_Rn01_00094290 predicted 533
3 SASI_Rn01_00094291 predicted 375
4 SASI_Rn01_00094292 predicted 761
5 SASI_Rn02_00202449 predicted 229
6 SASI_Rn01_00094294 predicted 456
7 SASI_Rn01_00094295 predicted 448
8 SASI_Rn01_00094296 predicted 531
9 SASI_Rn01_00094298 predicted 371
10 SASI_Rn01_00094299 predicted 336
11 SASI_Rn01_00094293 predicted 751
12 SASI_Rn01_00094297 predicted 591
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040444
PHF11 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 11
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000378317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040444.1-512s21c1
Sequence:CCGGCCACCGTGGGATGTGATTTAACTCGAGTTAAATCACATCCCACGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040444.1-593s21c1
Sequence:CCGGCTGATGGAGTTCGAGGAATTTCTCGAGAAATTCCTCGAACTCCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040444.1-652s21c1
Sequence:CCGGATCGCTCAAAGTGCTAAATTTCTCGAGAAATTTAGCACTTTGAGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040444
PHF11 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 11
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000378317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040444.1-512s21c1
Sequence:CCGGCCACCGTGGGATGTGATTTAACTCGAGTTAAATCACATCCCACGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040444.1-593s21c1
Sequence:CCGGCTGATGGAGTTCGAGGAATTTCTCGAGAAATTCCTCGAACTCCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040444.1-652s21c1
Sequence:CCGGATCGCTCAAAGTGCTAAATTTCTCGAGAAATTTAGCACTTTGAGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040444
PHF11 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 11
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000378317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040444.1-512s21c1
Sequence:CCGGCCACCGTGGGATGTGATTTAACTCGAGTTAAATCACATCCCACGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040444.1-593s21c1
Sequence:CCGGCTGATGGAGTTCGAGGAATTTCTCGAGAAATTCCTCGAACTCCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040444.1-652s21c1
Sequence:CCGGATCGCTCAAAGTGCTAAATTTCTCGAGAAATTTAGCACTTTGAGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016119
PHF11 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 11
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000020109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016119.1-156s1c1
Sequence:CCGGCCCAAAGATGTCGAATATAATCTCGAGATTATATTCGACATCTTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016119.1-503s1c1
Sequence:CCGGCATCGCTCAAAGTGCTAAATTCTCGAGAATTTAGCACTTTGAGCGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016119.1-167s1c1
Sequence:CCGGCGAATATAATGTCCTGTACTTCTCGAGAAGTACAGGACATTATATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016119.1-585s1c1
Sequence:CCGGCCCGAAACAATGAAATGTAATCTCGAGATTACATTTCATTGTTTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016119
PHF11 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 11
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000020109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016119.1-156s1c1
Sequence:CCGGCCCAAAGATGTCGAATATAATCTCGAGATTATATTCGACATCTTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016119.1-503s1c1
Sequence:CCGGCATCGCTCAAAGTGCTAAATTCTCGAGAATTTAGCACTTTGAGCGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016119.1-167s1c1
Sequence:CCGGCGAATATAATGTCCTGTACTTCTCGAGAAGTACAGGACATTATATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016119.1-585s1c1
Sequence:CCGGCCCGAAACAATGAAATGTAATCTCGAGATTACATTTCATTGTTTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016119
PHF11 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 11
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000020109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016119.1-156s1c1
Sequence:CCGGCCCAAAGATGTCGAATATAATCTCGAGATTATATTCGACATCTTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016119.1-503s1c1
Sequence:CCGGCATCGCTCAAAGTGCTAAATTCTCGAGAATTTAGCACTTTGAGCGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016119.1-167s1c1
Sequence:CCGGCGAATATAATGTCCTGTACTTCTCGAGAAGTACAGGACATTATATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016119.1-585s1c1
Sequence:CCGGCCCGAAACAATGAAATGTAATCTCGAGATTACATTTCATTGTTTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)