EMAIL THIS PAGE TO A FRIEND

PHF12

PHD finger protein 12

144 Gene Product Result for
Synonyms: PF1
UniProtKB ID: Q96QT6, Q0VAI5, Q6ZML2, Q9BV34, Q9H7U9, Q9P205
Gene ID:
Mouse(268448) PHD finger protein 12
Rat(303274) PHD finger protein 12
cow(507057) PHD finger protein 12
sheep(101108667) PHD finger protein 12
domestic guinea pig(100725570) PHD finger protein 12
naked mole-rat(101721891) PHD finger protein 12
Domestic Rabbit(100343837) PHD finger protein 12
chicken(417580) PHD finger protein 12
Horse(100059567) PHD finger protein 12
domestic cat(101094964) PHD finger protein 12
dog(491174) PHD finger protein 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174852 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174852 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174852 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020889 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020889 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020889 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033561 Rosetta Predictions human pricing
NM_020889 Rosetta Predictions human pricing
NM_001013117 Rosetta Predictions rat pricing
NM_174852 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308053 predicted 1656
2 SASI_Hs01_00048190 predicted 1193
3 SASI_Hs01_00048192 predicted 1913
4 SASI_Hs02_00308054 predicted 2377
5 SASI_Hs01_00048193 predicted 1931
6 SASI_Hs01_00048194 predicted 1334
7 SASI_Hs01_00048195 predicted 1391
8 SASI_Hs02_00308055 predicted 2021
9 SASI_Hs02_00308056 predicted 2158
10 SASI_Hs02_00308057 predicted 2159
11 SASI_Hs01_00048191 predicted 1907
12 SASI_Hs01_00048196 predicted 1974
13 SASI_Hs01_00048197 predicted 1068
14 SASI_Hs01_00048198 predicted 780
15 SASI_Hs01_00048199 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236241 predicted 1653
2 SASI_Hs01_00236242 predicted 1196
3 SASI_Hs01_00236244 predicted 1911
4 SASI_Hs02_00354199 predicted 2374
5 SASI_Hs01_00236245 predicted 1927
6 SASI_Hs01_00236246 predicted 1339
7 SASI_Hs01_00236247 predicted 1395
8 SASI_Hs01_00236248 predicted 2021
9 SASI_Hs01_00236249 predicted 2157
10 SASI_Hs01_00236250 predicted 2160
11 SASI_Hs01_00236243 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200815 predicted 2970
2 SASI_Rn02_00200816 predicted 1214
3 SASI_Rn02_00200817 predicted 2498
4 SASI_Rn02_00200818 predicted 2729
5 SASI_Rn02_00200819 predicted 3203
6 SASI_Rn02_00200820 predicted 1528
7 SASI_Rn02_00200821 predicted 1361
8 SASI_Rn02_00200822 predicted 2108
9 SASI_Rn02_00200823 predicted 2163
10 SASI_Rn02_00200824 predicted 3144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175663 predicted 2512
2 SASI_Mm01_00175664 predicted 2600
3 SASI_Mm01_00175665 predicted 2274
4 SASI_Mm01_00175666 predicted 886
5 SASI_Mm01_00175667 predicted 2020
6 SASI_Mm01_00175668 predicted 2042
7 SASI_Mm01_00175670 predicted 1352
8 SASI_Mm01_00175671 predicted 2683
9 SASI_Mm02_00345504 predicted 2737
10 SASI_Mm01_00175672 predicted 2584
11 SASI_Mm01_00175669 predicted 2742
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174852
VALIDATED
PHF12 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174852.2-3636s1c1
Sequence:CCGGGCTACTGTGTATATGGACAAACTCGAGTTTGTCCATATACACAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174852.2-2307s1c1
Sequence:CCGGCGGAGAAATCGAGATAAATATCTCGAGATATTTATCTCGATTTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174852.2-1161s1c1
Sequence:CCGGCCTGAACCGAATCCACAAGAACTCGAGTTCTTGTGGATTCGGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174852.2-2739s1c1
Sequence:CCGGCCCAAGCAGTATTGTTGCCAACTCGAGTTGGCAACAATACTGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174852.2-2276s1c1
Sequence:CCGGCCAACTCACTTCGAGCATTTACTCGAGTAAATGCTCGAAGTGAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174852.3-1269s21c1
Sequence:CCGGAGCATGAGTTAGACCATAATGCTCGAGCATTATGGTCTAACTCATGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174852.3-1627s21c1
Sequence:CCGGGAAGGTTCCTGATGCTATAAACTCGAGTTTATAGCATCAGGAACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174852.3-1807s21c1
Sequence:CCGGTGCGCTCCAGTGCAGCATATTCTCGAGAATATGCTGCACTGGAGCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174852.3-1875s21c1
Sequence:CCGGAGACAGAGAAGGCTGATATTACTCGAGTAATATCAGCCTTCTCTGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174852
VALIDATED
PHF12 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174852.2-3636s1c1
Sequence:CCGGGCTACTGTGTATATGGACAAACTCGAGTTTGTCCATATACACAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174852.2-2307s1c1
Sequence:CCGGCGGAGAAATCGAGATAAATATCTCGAGATATTTATCTCGATTTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174852.2-1161s1c1
Sequence:CCGGCCTGAACCGAATCCACAAGAACTCGAGTTCTTGTGGATTCGGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174852.2-2739s1c1
Sequence:CCGGCCCAAGCAGTATTGTTGCCAACTCGAGTTGGCAACAATACTGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174852.2-2276s1c1
Sequence:CCGGCCAACTCACTTCGAGCATTTACTCGAGTAAATGCTCGAAGTGAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174852.3-1269s21c1
Sequence:CCGGAGCATGAGTTAGACCATAATGCTCGAGCATTATGGTCTAACTCATGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174852.3-1627s21c1
Sequence:CCGGGAAGGTTCCTGATGCTATAAACTCGAGTTTATAGCATCAGGAACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174852.3-1807s21c1
Sequence:CCGGTGCGCTCCAGTGCAGCATATTCTCGAGAATATGCTGCACTGGAGCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174852.3-1875s21c1
Sequence:CCGGAGACAGAGAAGGCTGATATTACTCGAGTAATATCAGCCTTCTCTGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174852
VALIDATED
PHF12 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174852.2-3636s1c1
Sequence:CCGGGCTACTGTGTATATGGACAAACTCGAGTTTGTCCATATACACAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174852.2-2307s1c1
Sequence:CCGGCGGAGAAATCGAGATAAATATCTCGAGATATTTATCTCGATTTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174852.2-1161s1c1
Sequence:CCGGCCTGAACCGAATCCACAAGAACTCGAGTTCTTGTGGATTCGGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174852.2-2739s1c1
Sequence:CCGGCCCAAGCAGTATTGTTGCCAACTCGAGTTGGCAACAATACTGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_174852.2-2276s1c1
Sequence:CCGGCCAACTCACTTCGAGCATTTACTCGAGTAAATGCTCGAAGTGAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174852.3-1269s21c1
Sequence:CCGGAGCATGAGTTAGACCATAATGCTCGAGCATTATGGTCTAACTCATGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174852.3-1627s21c1
Sequence:CCGGGAAGGTTCCTGATGCTATAAACTCGAGTTTATAGCATCAGGAACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174852.3-1807s21c1
Sequence:CCGGTGCGCTCCAGTGCAGCATATTCTCGAGAATATGCTGCACTGGAGCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174852.3-1875s21c1
Sequence:CCGGAGACAGAGAAGGCTGATATTACTCGAGTAATATCAGCCTTCTCTGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020889
VALIDATED
PHF12 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020889.1-1922s1c1
Sequence:CCGGGCTGATATTAAGCCTGTTATTCTCGAGAATAACAGGCTTAATATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020889.1-2434s1c1
Sequence:CCGGCATCGAGAACACCAGCACTTTCTCGAGAAAGTGCTGGTGTTCTCGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_020889.1-1409s1c1
Sequence:CCGGCCTCTCCTGTTTCACATGGATCTCGAGATCCATGTGAAACAGGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020889.1-848s1c1
Sequence:CCGGCGAAAGAAACGAGAGCAGAAACTCGAGTTTCTGCTCTCGTTTCTTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_020889.1-1385s1c1
Sequence:CCGGCCTCTCATCCAGTGTGACTATCTCGAGATAGTCACACTGGATGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020889.2-1661s21c1
Sequence:GTACCGGGAAGGTTCCTGATGCTATAAACTCGAGTTTATAGCATCAGGAACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020889.2-2778s21c1
Sequence:CCGGTGTTAACTTGTCCCGTTTATACTCGAGTATAAACGGGACAAGTTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020889.2-1841s21c1
Sequence:CCGGTGCGCTCCAGTGCAGCATATTCTCGAGAATATGCTGCACTGGAGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020889.2-1564s21c1
Sequence:CCGGTTTCGCAGCATGTCGTCAAAGCTCGAGCTTTGACGACATGCTGCGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020889.2-1327s21c1
Sequence:CCGGTCGTTCCCTTACCCGTCAAAGCTCGAGCTTTGACGGGTAAGGGAACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020889
VALIDATED
PHF12 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020889.1-1922s1c1
Sequence:CCGGGCTGATATTAAGCCTGTTATTCTCGAGAATAACAGGCTTAATATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020889.1-2434s1c1
Sequence:CCGGCATCGAGAACACCAGCACTTTCTCGAGAAAGTGCTGGTGTTCTCGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_020889.1-1409s1c1
Sequence:CCGGCCTCTCCTGTTTCACATGGATCTCGAGATCCATGTGAAACAGGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020889.1-848s1c1
Sequence:CCGGCGAAAGAAACGAGAGCAGAAACTCGAGTTTCTGCTCTCGTTTCTTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_020889.1-1385s1c1
Sequence:CCGGCCTCTCATCCAGTGTGACTATCTCGAGATAGTCACACTGGATGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020889.2-1661s21c1
Sequence:GTACCGGGAAGGTTCCTGATGCTATAAACTCGAGTTTATAGCATCAGGAACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020889.2-2778s21c1
Sequence:CCGGTGTTAACTTGTCCCGTTTATACTCGAGTATAAACGGGACAAGTTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020889.2-1841s21c1
Sequence:CCGGTGCGCTCCAGTGCAGCATATTCTCGAGAATATGCTGCACTGGAGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020889.2-1564s21c1
Sequence:CCGGTTTCGCAGCATGTCGTCAAAGCTCGAGCTTTGACGACATGCTGCGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020889.2-1327s21c1
Sequence:CCGGTCGTTCCCTTACCCGTCAAAGCTCGAGCTTTGACGGGTAAGGGAACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020889
VALIDATED
PHF12 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020889.1-1922s1c1
Sequence:CCGGGCTGATATTAAGCCTGTTATTCTCGAGAATAACAGGCTTAATATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020889.1-2434s1c1
Sequence:CCGGCATCGAGAACACCAGCACTTTCTCGAGAAAGTGCTGGTGTTCTCGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_020889.1-1409s1c1
Sequence:CCGGCCTCTCCTGTTTCACATGGATCTCGAGATCCATGTGAAACAGGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020889.1-848s1c1
Sequence:CCGGCGAAAGAAACGAGAGCAGAAACTCGAGTTTCTGCTCTCGTTTCTTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_020889.1-1385s1c1
Sequence:CCGGCCTCTCATCCAGTGTGACTATCTCGAGATAGTCACACTGGATGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020889.2-1661s21c1
Sequence:GTACCGGGAAGGTTCCTGATGCTATAAACTCGAGTTTATAGCATCAGGAACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020889.2-2778s21c1
Sequence:CCGGTGTTAACTTGTCCCGTTTATACTCGAGTATAAACGGGACAAGTTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020889.2-1841s21c1
Sequence:CCGGTGCGCTCCAGTGCAGCATATTCTCGAGAATATGCTGCACTGGAGCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020889.2-1564s21c1
Sequence:CCGGTTTCGCAGCATGTCGTCAAAGCTCGAGCTTTGACGACATGCTGCGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020889.2-1327s21c1
Sequence:CCGGTCGTTCCCTTACCCGTCAAAGCTCGAGCTTTGACGGGTAAGGGAACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)