EMAIL THIS PAGE TO A FRIEND

PHF13

PHD finger protein 13

95 Gene Product Result for
Synonyms: PHF5 SPOC1
UniProtKB ID: Q86YI8, B3KUQ7, Q59FB6, Q5TH65, Q8N551, Q9UJP2
Gene ID:
Mouse(230936) PHD finger protein 13
Rat(313742) PHD finger protein 13
Zebrafish(560078) PHD finger protein 19
chicken(428174) PHD finger protein 13
chicken(101750144) PHD finger protein 13
chicken(101665277) PHD finger protein 13
domestic cat(101092377) PHD finger protein 13
dog(479592) PHD finger protein 13
naked mole-rat(101699788) PHD finger protein 13
domestic guinea pig(100732758) PHD finger protein 13
cow(540889) PHD finger protein 13
sheep(101116162) PHD finger protein 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153812 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172705 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172705 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172705 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153812 Rosetta Predictions human pricing
NM_001107995 Rosetta Predictions rat pricing
NM_172705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157031 predicted 1064
2 SASI_Hs01_00157032 predicted 1756
3 SASI_Hs02_00367490 predicted 1662
4 SASI_Hs01_00157035 predicted 1673
5 SASI_Hs01_00157036 predicted 1065
6 SASI_Hs01_00157037 predicted 1224
7 SASI_Hs01_00157039 predicted 1172
8 SASI_Hs01_00157040 predicted 1573
9 SASI_Hs02_00367491 predicted 1155
10 SASI_Hs02_00367492 predicted 1426
11 SASI_Hs01_00157033 predicted 1683
12 SASI_Hs01_00157034 predicted 1395
13 SASI_Hs01_00157038 predicted 1536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234325 predicted 1350
2 SASI_Rn02_00234326 predicted 1449
3 SASI_Rn02_00234327 predicted 1107
4 SASI_Rn02_00234328 predicted 854
5 SASI_Rn02_00234329 predicted 989
6 SASI_Rn02_00234330 predicted 1035
7 SASI_Rn02_00234331 predicted 887
8 SASI_Rn02_00234332 predicted 502
9 SASI_Rn02_00234333 predicted 1096
10 SASI_Rn02_00234334 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344467 predicted 597
2 SASI_Mm01_00140560 predicted 896
3 SASI_Mm02_00344468 predicted 603
4 SASI_Mm02_00344469 predicted 857
5 SASI_Mm01_00140563 predicted 1092
6 SASI_Mm02_00344470 predicted 838
7 SASI_Mm02_00344471 predicted 1214
8 SASI_Mm01_00140564 predicted 1583
9 SASI_Mm02_00344472 predicted 1003
10 SASI_Mm02_00344473 predicted 1083
11 SASI_Mm01_00140557 predicted 512
12 SASI_Mm01_00140558 predicted 374
13 SASI_Mm01_00140559 predicted 934
14 SASI_Mm01_00140561 predicted 837
15 SASI_Mm01_00140562 predicted 762
16 SASI_Mm01_00140565 predicted 1150
17 SASI_Mm01_00140566 predicted 992
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153812
VALIDATED
PHF13 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 13
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_153812.2-1587s21c1
Sequence:CCGGCTAAGAGATTCCCGCTGATTGCTCGAGCAATCAGCGGGAATCTCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153812.2-2873s21c1
Sequence:CCGGACACTTGTCCAACCGTCTTATCTCGAGATAAGACGGTTGGACAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153812.2-830s21c1
Sequence:CCGGGAGTCCCACCTTGCAGGATATCTCGAGATATCCTGCAAGGTGGGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153812.2-504s21c1
Sequence:CCGGCCGAAGGAGGAACTCCCTTTACTCGAGTAAAGGGAGTTCCTCCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153812.2-1006s21c1
Sequence:CCGGAGGACAGCACTGGCAATGATGCTCGAGCATCATTGCCAGTGCTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153812.1-1172s1c1
Sequence:CCGGCGGAAATCCAATGTTCCAGAACTCGAGTTCTGGAACATTGGATTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153812.1-453s1c1
Sequence:CCGGCCGTGGAAGACTTCAACAAATCTCGAGATTTGTTGAAGTCTTCCACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153812.1-938s1c1
Sequence:CCGGCCTGATCAGGTCAAAGAAATACTCGAGTATTTCTTTGACCTGATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153812.1-516s1c1
Sequence:CCGGCGAAGGAGGAACTCCCTTTAACTCGAGTTAAAGGGAGTTCCTCCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153812.1-1188s1c1
Sequence:CCGGCAGAAGTGTTTGTCTGCCAAACTCGAGTTTGGCAGACAAACACTTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_153812.2-922s21c1
Sequence:CCGGTGTCACCTGATCAGGTCAAAGCTCGAGCTTTGACCTGATCAGGTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153812.2-951s21c1
Sequence:CCGGACTGAAGGCAAACGGACTATCCTCGAGGATAGTCCGTTTGCCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153812
VALIDATED
PHF13 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 13
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_153812.2-1587s21c1
Sequence:CCGGCTAAGAGATTCCCGCTGATTGCTCGAGCAATCAGCGGGAATCTCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153812.2-2873s21c1
Sequence:CCGGACACTTGTCCAACCGTCTTATCTCGAGATAAGACGGTTGGACAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153812.2-830s21c1
Sequence:CCGGGAGTCCCACCTTGCAGGATATCTCGAGATATCCTGCAAGGTGGGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153812.2-504s21c1
Sequence:CCGGCCGAAGGAGGAACTCCCTTTACTCGAGTAAAGGGAGTTCCTCCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153812.2-1006s21c1
Sequence:CCGGAGGACAGCACTGGCAATGATGCTCGAGCATCATTGCCAGTGCTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153812.1-1172s1c1
Sequence:CCGGCGGAAATCCAATGTTCCAGAACTCGAGTTCTGGAACATTGGATTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153812.1-453s1c1
Sequence:CCGGCCGTGGAAGACTTCAACAAATCTCGAGATTTGTTGAAGTCTTCCACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153812.1-938s1c1
Sequence:CCGGCCTGATCAGGTCAAAGAAATACTCGAGTATTTCTTTGACCTGATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153812.1-516s1c1
Sequence:CCGGCGAAGGAGGAACTCCCTTTAACTCGAGTTAAAGGGAGTTCCTCCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153812.1-1188s1c1
Sequence:CCGGCAGAAGTGTTTGTCTGCCAAACTCGAGTTTGGCAGACAAACACTTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_153812.2-922s21c1
Sequence:CCGGTGTCACCTGATCAGGTCAAAGCTCGAGCTTTGACCTGATCAGGTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153812.2-951s21c1
Sequence:CCGGACTGAAGGCAAACGGACTATCCTCGAGGATAGTCCGTTTGCCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153812
VALIDATED
PHF13 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 13
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_153812.2-1587s21c1
Sequence:CCGGCTAAGAGATTCCCGCTGATTGCTCGAGCAATCAGCGGGAATCTCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153812.2-2873s21c1
Sequence:CCGGACACTTGTCCAACCGTCTTATCTCGAGATAAGACGGTTGGACAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153812.2-830s21c1
Sequence:CCGGGAGTCCCACCTTGCAGGATATCTCGAGATATCCTGCAAGGTGGGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153812.2-504s21c1
Sequence:CCGGCCGAAGGAGGAACTCCCTTTACTCGAGTAAAGGGAGTTCCTCCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153812.2-1006s21c1
Sequence:CCGGAGGACAGCACTGGCAATGATGCTCGAGCATCATTGCCAGTGCTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153812.1-1172s1c1
Sequence:CCGGCGGAAATCCAATGTTCCAGAACTCGAGTTCTGGAACATTGGATTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153812.1-453s1c1
Sequence:CCGGCCGTGGAAGACTTCAACAAATCTCGAGATTTGTTGAAGTCTTCCACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153812.1-938s1c1
Sequence:CCGGCCTGATCAGGTCAAAGAAATACTCGAGTATTTCTTTGACCTGATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153812.1-516s1c1
Sequence:CCGGCGAAGGAGGAACTCCCTTTAACTCGAGTTAAAGGGAGTTCCTCCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153812.1-1188s1c1
Sequence:CCGGCAGAAGTGTTTGTCTGCCAAACTCGAGTTTGGCAGACAAACACTTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_153812.2-922s21c1
Sequence:CCGGTGTCACCTGATCAGGTCAAAGCTCGAGCTTTGACCTGATCAGGTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153812.2-951s21c1
Sequence:CCGGACTGAAGGCAAACGGACTATCCTCGAGGATAGTCCGTTTGCCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172705
PHF13 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 13
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172705.2-600s21c1
Sequence:CCGGGAGAGCTAAGCCCAGTAACTACTCGAGTAGTTACTGGGCTTAGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172705.2-1097s21c1
Sequence:CCGGAGTCCAATGTCCCGGAAGTTTCTCGAGAAACTTCCGGGACATTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172705.2-409s21c1
Sequence:CCGGTGCACCTTCGTCTTGGCATATCTCGAGATATGCCAAGACGAAGGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172705.2-2741s21c1
Sequence:CCGGCAGTGGAGCTGGCCATTATTACTCGAGTAATAATGGCCAGCTCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172705.1-660s1c1
Sequence:CCGGGTTTGATATCCGTCGCTCCAACTCGAGTTGGAGCGACGGATATCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172705.2-1134s21c1
Sequence:CCGGCCGGGACTCCAAGTTTGATATCTCGAGATATCAAACTTGGAGTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172705
PHF13 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 13
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172705.2-600s21c1
Sequence:CCGGGAGAGCTAAGCCCAGTAACTACTCGAGTAGTTACTGGGCTTAGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172705.2-1097s21c1
Sequence:CCGGAGTCCAATGTCCCGGAAGTTTCTCGAGAAACTTCCGGGACATTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172705.2-409s21c1
Sequence:CCGGTGCACCTTCGTCTTGGCATATCTCGAGATATGCCAAGACGAAGGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172705.2-2741s21c1
Sequence:CCGGCAGTGGAGCTGGCCATTATTACTCGAGTAATAATGGCCAGCTCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172705.1-660s1c1
Sequence:CCGGGTTTGATATCCGTCGCTCCAACTCGAGTTGGAGCGACGGATATCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172705.2-1134s21c1
Sequence:CCGGCCGGGACTCCAAGTTTGATATCTCGAGATATCAAACTTGGAGTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172705
PHF13 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 13
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172705.2-600s21c1
Sequence:CCGGGAGAGCTAAGCCCAGTAACTACTCGAGTAGTTACTGGGCTTAGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172705.2-1097s21c1
Sequence:CCGGAGTCCAATGTCCCGGAAGTTTCTCGAGAAACTTCCGGGACATTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172705.2-409s21c1
Sequence:CCGGTGCACCTTCGTCTTGGCATATCTCGAGATATGCCAAGACGAAGGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172705.2-2741s21c1
Sequence:CCGGCAGTGGAGCTGGCCATTATTACTCGAGTAATAATGGCCAGCTCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172705.1-660s1c1
Sequence:CCGGGTTTGATATCCGTCGCTCCAACTCGAGTTGGAGCGACGGATATCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172705.2-1134s21c1
Sequence:CCGGCCGGGACTCCAAGTTTGATATCTCGAGATATCAAACTTGGAGTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)