EMAIL THIS PAGE TO A FRIEND

PHF14

PHD finger protein 14

104 Gene Product Result for
UniProtKB ID: O94880, A7MCZ3, B4DI82
Gene ID:
Mouse(75725) PHD finger protein 14
Rat(500030) PHD finger protein 14
cow(537811) PHD finger protein 14
sheep(100135443) PHD finger protein 14
domestic guinea pig(100727141) PHD finger protein 14
Zebrafish(555505) PHD finger protein 14
chicken(420583) PHD finger protein 14
domestic cat(101080518) PHD finger protein 14
Horse(100064762) PHD finger protein 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376578 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376578 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376578 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001007157 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007157 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007157 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029404 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029404 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029404 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007157 Rosetta Predictions human pricing
NM_014660 Rosetta Predictions human pricing
NM_001110492 Rosetta Predictions rat pricing
NM_029404 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151930 predicted 2655
2 SASI_Hs01_00151931 predicted 1972
3 SASI_Hs01_00151932 predicted 2837
4 SASI_Hs02_00305240 predicted 2057
5 SASI_Hs02_00305241 predicted 2199
6 SASI_Hs01_00151933 predicted 1706
7 SASI_Hs01_00151934 predicted 2622
8 SASI_Hs01_00151935 predicted 1827
9 SASI_Hs02_00305242 predicted 1656
10 SASI_Hs01_00151936 predicted 2502
11 SASI_Hs01_00151929 predicted 1710
12 SASI_Hs01_00151937 predicted 2075
13 SASI_Hs01_00151938 predicted 2488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136291 predicted 2655
2 SASI_Hs01_00136292 predicted 1969
3 SASI_Hs01_00136293 predicted 2835
4 SASI_Hs02_00346000 predicted 2056
5 SASI_Hs02_00346001 predicted 2198
6 SASI_Hs01_00136294 predicted 1706
7 SASI_Hs01_00136295 predicted 2623
8 SASI_Hs01_00136296 predicted 1827
9 SASI_Hs02_00346002 predicted 1653
10 SASI_Hs01_00136297 predicted 2507
11 SASI_Hs01_00136290 predicted 1712
12 SASI_Hs01_00136298 predicted 2084
13 SASI_Hs01_00136299 predicted 2488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110492 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251272 predicted 1589
2 SASI_Rn02_00251273 predicted 1440
3 SASI_Rn02_00251274 predicted 2427
4 SASI_Rn02_00251275 predicted 1537
5 SASI_Rn02_00251276 predicted 2248
6 SASI_Rn02_00251277 predicted 2972
7 SASI_Rn02_00251278 predicted 2635
8 SASI_Rn02_00251279 predicted 2121
9 SASI_Rn02_00251280 predicted 2567
10 SASI_Rn02_00251281 predicted 2781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121490 predicted 2437
2 SASI_Mm01_00121491 predicted 3017
3 SASI_Mm01_00121492 predicted 1927
4 SASI_Mm01_00121493 predicted 2618
5 SASI_Mm01_00121494 predicted 1595
6 SASI_Mm01_00121495 predicted 2543
7 SASI_Mm01_00121496 predicted 2579
8 SASI_Mm01_00121497 predicted 1665
9 SASI_Mm02_00335301 predicted 2450
10 SASI_Mm01_00121498 predicted 2788
11 SASI_Mm01_00121499 predicted 2650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376578
VALIDATED
PHF14 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 14
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_376578.1-2320s1c1
Sequence:CCGGCGCATGATTCAAATTCAGGAACTCGAGTTCCTGAATTTGAATCATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_376578.1-605s1c1
Sequence:CCGGCCTGTAGTGATTCTGAAGAAACTCGAGTTTCTTCAGAATCACTACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:XM_376578.1-1196s1c1
Sequence:CCGGGCAATGATGAAGATCATAGTACTCGAGTACTATGATCTTCATCATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376578.1-2891s1c1
Sequence:CCGGCCAAGAAGATTCCGATAAGAACTCGAGTTCTTATCGGAATCTTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376578.1-1897s1c1
Sequence:CCGGGCAGATCCATTCTTTGCTTATCTCGAGATAAGCAAAGAATGGATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376578
VALIDATED
PHF14 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 14
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_376578.1-2320s1c1
Sequence:CCGGCGCATGATTCAAATTCAGGAACTCGAGTTCCTGAATTTGAATCATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_376578.1-605s1c1
Sequence:CCGGCCTGTAGTGATTCTGAAGAAACTCGAGTTTCTTCAGAATCACTACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:XM_376578.1-1196s1c1
Sequence:CCGGGCAATGATGAAGATCATAGTACTCGAGTACTATGATCTTCATCATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376578.1-2891s1c1
Sequence:CCGGCCAAGAAGATTCCGATAAGAACTCGAGTTCTTATCGGAATCTTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376578.1-1897s1c1
Sequence:CCGGGCAGATCCATTCTTTGCTTATCTCGAGATAAGCAAAGAATGGATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376578
VALIDATED
PHF14 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 14
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_376578.1-2320s1c1
Sequence:CCGGCGCATGATTCAAATTCAGGAACTCGAGTTCCTGAATTTGAATCATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_376578.1-605s1c1
Sequence:CCGGCCTGTAGTGATTCTGAAGAAACTCGAGTTTCTTCAGAATCACTACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:XM_376578.1-1196s1c1
Sequence:CCGGGCAATGATGAAGATCATAGTACTCGAGTACTATGATCTTCATCATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376578.1-2891s1c1
Sequence:CCGGCCAAGAAGATTCCGATAAGAACTCGAGTTCTTATCGGAATCTTCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376578.1-1897s1c1
Sequence:CCGGGCAGATCCATTCTTTGCTTATCTCGAGATAAGCAAAGAATGGATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007157
VALIDATED
PHF14 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 14
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007157.1-2150s21c1
Sequence:GTACCGGGTGCTTCAGCTATTCGTAAACCTCGAGGTTTACGAATAGCTGAAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007157.1-605s21c1
Sequence:CCGGCCTGTAGTGATTCTGAAGAAACTCGAGTTTCTTCAGAATCACTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007157.1-2830s21c1
Sequence:CCGGCGATCAAGGAGGCAGATTAAGCTCGAGCTTAATCTGCCTCCTTGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007157.1-2513s21c1
Sequence:CCGGAGTTGAATATACCGGCAATTTCTCGAGAAATTGCCGGTATATTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007157.1-1707s21c1
Sequence:GTACCGGACCAGTAACACTAACGGAAATCTCGAGATTTCCGTTAGTGTTACTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001007157.1-1816s21c1
Sequence:CCGGGGGATGTGCAGAGCCTATTTCCTCGAGGAAATAGGCTCTGCACATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001007157.1-2320s21c1
Sequence:CCGGCGCATGATTCAAATTCAGGAACTCGAGTTCCTGAATTTGAATCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007157
VALIDATED
PHF14 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 14
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007157.1-2150s21c1
Sequence:GTACCGGGTGCTTCAGCTATTCGTAAACCTCGAGGTTTACGAATAGCTGAAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007157.1-605s21c1
Sequence:CCGGCCTGTAGTGATTCTGAAGAAACTCGAGTTTCTTCAGAATCACTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007157.1-2830s21c1
Sequence:CCGGCGATCAAGGAGGCAGATTAAGCTCGAGCTTAATCTGCCTCCTTGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007157.1-2513s21c1
Sequence:CCGGAGTTGAATATACCGGCAATTTCTCGAGAAATTGCCGGTATATTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007157.1-1707s21c1
Sequence:GTACCGGACCAGTAACACTAACGGAAATCTCGAGATTTCCGTTAGTGTTACTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001007157.1-1816s21c1
Sequence:CCGGGGGATGTGCAGAGCCTATTTCCTCGAGGAAATAGGCTCTGCACATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001007157.1-2320s21c1
Sequence:CCGGCGCATGATTCAAATTCAGGAACTCGAGTTCCTGAATTTGAATCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007157
VALIDATED
PHF14 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 14
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007157.1-2150s21c1
Sequence:GTACCGGGTGCTTCAGCTATTCGTAAACCTCGAGGTTTACGAATAGCTGAAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007157.1-605s21c1
Sequence:CCGGCCTGTAGTGATTCTGAAGAAACTCGAGTTTCTTCAGAATCACTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007157.1-2830s21c1
Sequence:CCGGCGATCAAGGAGGCAGATTAAGCTCGAGCTTAATCTGCCTCCTTGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007157.1-2513s21c1
Sequence:CCGGAGTTGAATATACCGGCAATTTCTCGAGAAATTGCCGGTATATTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007157.1-1707s21c1
Sequence:GTACCGGACCAGTAACACTAACGGAAATCTCGAGATTTCCGTTAGTGTTACTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001007157.1-1816s21c1
Sequence:CCGGGGGATGTGCAGAGCCTATTTCCTCGAGGAAATAGGCTCTGCACATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001007157.1-2320s21c1
Sequence:CCGGCGCATGATTCAAATTCAGGAACTCGAGTTCCTGAATTTGAATCATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029404
VALIDATED
PHF14 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 14
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029404.1-682s1c1
Sequence:CCGGCCATCAGACAAACAGTTAATTCTCGAGAATTAACTGTTTGTCTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029404.1-3115s1c1
Sequence:CCGGGAAGAAACTACTCAAAGTGATCTCGAGATCACTTTGAGTAGTTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029404.1-1736s1c1
Sequence:CCGGGCTTTGCTAGAACTGGAGTTTCTCGAGAAACTCCAGTTCTAGCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029404.1-2494s1c1
Sequence:CCGGCGAGCACCTAAGGAAAGGAAACTCGAGTTTCCTTTCCTTAGGTGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029404.1-3082s1c1
Sequence:CCGGCAAGCTTCAAAGACTTTGTATCTCGAGATACAAAGTCTTTGAAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029404.1-2623s1c1
Sequence:CCGGGACACCTGTAAACTGCATTATCTCGAGATAATGCAGTTTACAGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029404.1-3093s1c1
Sequence:CCGGGACTTTGTATCTCTGGCTAAACTCGAGTTTAGCCAGAGATACAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029404.1-3077s1c1
Sequence:CCGGCTCCTCAAGCTTCAAAGACTTCTCGAGAAGTCTTTGAAGCTTGAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029404.2-2439s1c1
Sequence:CCGGGGCCTTACTTGGCCGAATTACCTCGAGGTAATTCGGCCAAGTAAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029404.2-1423s1c1
Sequence:CCGGACAGTTCATGAAGGTTGTTATCTCGAGATAACAACCTTCATGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029404
VALIDATED
PHF14 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 14
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029404.1-682s1c1
Sequence:CCGGCCATCAGACAAACAGTTAATTCTCGAGAATTAACTGTTTGTCTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029404.1-3115s1c1
Sequence:CCGGGAAGAAACTACTCAAAGTGATCTCGAGATCACTTTGAGTAGTTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029404.1-1736s1c1
Sequence:CCGGGCTTTGCTAGAACTGGAGTTTCTCGAGAAACTCCAGTTCTAGCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029404.1-2494s1c1
Sequence:CCGGCGAGCACCTAAGGAAAGGAAACTCGAGTTTCCTTTCCTTAGGTGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029404.1-3082s1c1
Sequence:CCGGCAAGCTTCAAAGACTTTGTATCTCGAGATACAAAGTCTTTGAAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029404.1-2623s1c1
Sequence:CCGGGACACCTGTAAACTGCATTATCTCGAGATAATGCAGTTTACAGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029404.1-3093s1c1
Sequence:CCGGGACTTTGTATCTCTGGCTAAACTCGAGTTTAGCCAGAGATACAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029404.1-3077s1c1
Sequence:CCGGCTCCTCAAGCTTCAAAGACTTCTCGAGAAGTCTTTGAAGCTTGAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029404.2-2439s1c1
Sequence:CCGGGGCCTTACTTGGCCGAATTACCTCGAGGTAATTCGGCCAAGTAAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029404.2-1423s1c1
Sequence:CCGGACAGTTCATGAAGGTTGTTATCTCGAGATAACAACCTTCATGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029404
VALIDATED
PHF14 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 14
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029404.1-682s1c1
Sequence:CCGGCCATCAGACAAACAGTTAATTCTCGAGAATTAACTGTTTGTCTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029404.1-3115s1c1
Sequence:CCGGGAAGAAACTACTCAAAGTGATCTCGAGATCACTTTGAGTAGTTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029404.1-1736s1c1
Sequence:CCGGGCTTTGCTAGAACTGGAGTTTCTCGAGAAACTCCAGTTCTAGCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029404.1-2494s1c1
Sequence:CCGGCGAGCACCTAAGGAAAGGAAACTCGAGTTTCCTTTCCTTAGGTGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029404.1-3082s1c1
Sequence:CCGGCAAGCTTCAAAGACTTTGTATCTCGAGATACAAAGTCTTTGAAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029404.1-2623s1c1
Sequence:CCGGGACACCTGTAAACTGCATTATCTCGAGATAATGCAGTTTACAGGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029404.1-3093s1c1
Sequence:CCGGGACTTTGTATCTCTGGCTAAACTCGAGTTTAGCCAGAGATACAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198850    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029404.1-3077s1c1
Sequence:CCGGCTCCTCAAGCTTCAAAGACTTCTCGAGAAGTCTTTGAAGCTTGAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029404.2-2439s1c1
Sequence:CCGGGGCCTTACTTGGCCGAATTACCTCGAGGTAATTCGGCCAAGTAAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029404.2-1423s1c1
Sequence:CCGGACAGTTCATGAAGGTTGTTATCTCGAGATAACAACCTTCATGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)