EMAIL THIS PAGE TO A FRIEND

PHF15

PHD finger protein 15

251 Gene Product Result for
Synonyms: JADE2
UniProtKB ID: Q9NQC1, Q6IE80, Q8TEK0, Q92513, Q96GQ6
Gene ID:
Mouse(76901) PHD finger protein 15
Rat(303113) PHD finger protein 15
Zebrafish(569359) PHD finger protein 15
chicken(416315) PHD finger protein 15
Horse(100062894) PHD finger protein 15
domestic cat(101100177) PHD finger protein 15
dog(481508) PHD finger protein 15
domestic guinea pig(100724450) PHD finger protein 15
naked mole-rat(101702240) PHD finger protein 15
Domestic Rabbit(100339969) PHD finger protein 15
cow(512319) PHD finger protein 15
sheep(101103318) PHD finger protein 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199299 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199299 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199299 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015288 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015288 Rosetta Predictions human pricing
NM_001106998 Rosetta Predictions rat pricing
NM_199299 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194023 predicted 1632
2 SASI_Hs01_00194024 predicted 1192
3 SASI_Hs01_00194025 predicted 1654
4 SASI_Hs01_00194026 predicted 1203
5 SASI_Hs01_00194027 predicted 335
6 SASI_Hs01_00194028 predicted 1647
7 SASI_Hs01_00194029 predicted 634
8 SASI_Hs01_00194030 predicted 1225
9 SASI_Hs01_00194031 predicted 580
10 SASI_Hs01_00194032 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224476 predicted 1940
2 SASI_Rn02_00224477 predicted 965
3 SASI_Rn02_00224478 predicted 2479
4 SASI_Rn02_00224479 predicted 519
5 SASI_Rn02_00224480 predicted 2340
6 SASI_Rn02_00224481 predicted 496
7 SASI_Rn02_00224482 predicted 1660
8 SASI_Rn02_00224483 predicted 2356
9 SASI_Rn02_00224484 predicted 1127
10 SASI_Rn02_00224485 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199299 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135100 predicted 853
2 SASI_Mm01_00135101 predicted 1674
3 SASI_Mm01_00135102 predicted 1219
4 SASI_Mm01_00135103 predicted 1050
5 SASI_Mm01_00135104 predicted 1639
6 SASI_Mm01_00135105 predicted 1203
7 SASI_Mm01_00135106 predicted 2435
8 SASI_Mm01_00135107 predicted 1176
9 SASI_Mm01_00135108 predicted 1639
10 SASI_Mm02_00351420 predicted 1624
11 SASI_Mm01_00135109 predicted 332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199299
VALIDATED
PHF15 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 15
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199299.3-1057s21c1
Sequence:CCGGATTACCAAGATCTCGCATATTCTCGAGAATATGCGAGATCTTGGTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199299.1-1099s1c1
Sequence:CCGGCGGACTATATTAGCTGACAATCTCGAGATTGTCAGCTAATATAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199299.1-1756s1c1
Sequence:CCGGCTGTCAGAGGAATTGCTACAACTCGAGTTGTAGCAATTCCTCTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199299.1-71s1c1
Sequence:CCGGCCACATCAGCATCAAGATGTTCTCGAGAACATCTTGATGCTGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199299.1-2110s1c1
Sequence:CCGGGCTTCCGACTTAAATGTCCAACTCGAGTTGGACATTTAAGTCGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199299.1-1575s1c1
Sequence:CCGGCCATCTACAGATGAAACTTATCTCGAGATAAGTTTCATCTGTAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199299
VALIDATED
PHF15 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 15
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199299.3-1057s21c1
Sequence:CCGGATTACCAAGATCTCGCATATTCTCGAGAATATGCGAGATCTTGGTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199299.1-1099s1c1
Sequence:CCGGCGGACTATATTAGCTGACAATCTCGAGATTGTCAGCTAATATAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199299.1-1756s1c1
Sequence:CCGGCTGTCAGAGGAATTGCTACAACTCGAGTTGTAGCAATTCCTCTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199299.1-71s1c1
Sequence:CCGGCCACATCAGCATCAAGATGTTCTCGAGAACATCTTGATGCTGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199299.1-2110s1c1
Sequence:CCGGGCTTCCGACTTAAATGTCCAACTCGAGTTGGACATTTAAGTCGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199299.1-1575s1c1
Sequence:CCGGCCATCTACAGATGAAACTTATCTCGAGATAAGTTTCATCTGTAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199299
VALIDATED
PHF15 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 15
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199299.3-1057s21c1
Sequence:CCGGATTACCAAGATCTCGCATATTCTCGAGAATATGCGAGATCTTGGTAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199299.1-1099s1c1
Sequence:CCGGCGGACTATATTAGCTGACAATCTCGAGATTGTCAGCTAATATAGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199299.1-1756s1c1
Sequence:CCGGCTGTCAGAGGAATTGCTACAACTCGAGTTGTAGCAATTCCTCTGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199299.1-71s1c1
Sequence:CCGGCCACATCAGCATCAAGATGTTCTCGAGAACATCTTGATGCTGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199299.1-2110s1c1
Sequence:CCGGGCTTCCGACTTAAATGTCCAACTCGAGTTGGACATTTAAGTCGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199299.1-1575s1c1
Sequence:CCGGCCATCTACAGATGAAACTTATCTCGAGATAAGTTTCATCTGTAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015288
VALIDATED
PHF15 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 15
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015288.4-1064s21c1
Sequence:CCGGCATCACCAAGATCTCGCATATCTCGAGATATGCGAGATCTTGGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015288.4-1203s21c1
Sequence:CCGGGGCCTGGAAATGCGGACTATACTCGAGTATAGTCCGCATTTCCAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015288.4-586s21c1
Sequence:CCGGGCTATGACTTGGACGAGATTGCTCGAGCAATCTCGTCCAAGTCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_015288.4-1204s1c1
Sequence:CCGGGCCTGGAAATGCGGACTATATCTCGAGATATAGTCCGCATTTCCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015288.4-623s1c1
Sequence:CCGGGCTCATCAACTCGGAGCTTAACTCGAGTTAAGCTCCGAGTTGATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015288.4-2123s1c1
Sequence:CCGGACGTCGGACATCTTCTCACTTCTCGAGAAGTGAGAAGATGTCCGACGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015288.4-244s1c1
Sequence:CCGGCGACATCTACATCCGCATCAACTCGAGTTGATGCGGATGTAGATGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015288.4-1214s1c1
Sequence:CCGGGCGGACTATATTAGCAGACAACTCGAGTTGTCTGCTAATATAGTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015288
VALIDATED
PHF15 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 15
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015288.4-1064s21c1
Sequence:CCGGCATCACCAAGATCTCGCATATCTCGAGATATGCGAGATCTTGGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015288.4-1203s21c1
Sequence:CCGGGGCCTGGAAATGCGGACTATACTCGAGTATAGTCCGCATTTCCAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015288.4-586s21c1
Sequence:CCGGGCTATGACTTGGACGAGATTGCTCGAGCAATCTCGTCCAAGTCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_015288.4-1204s1c1
Sequence:CCGGGCCTGGAAATGCGGACTATATCTCGAGATATAGTCCGCATTTCCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015288.4-623s1c1
Sequence:CCGGGCTCATCAACTCGGAGCTTAACTCGAGTTAAGCTCCGAGTTGATGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015288.4-2123s1c1
Sequence:CCGGACGTCGGACATCTTCTCACTTCTCGAGAAGTGAGAAGATGTCCGACGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015288.4-244s1c1
Sequence:CCGGCGACATCTACATCCGCATCAACTCGAGTTGATGCGGATGTAGATGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015288.4-1214s1c1
Sequence:CCGGGCGGACTATATTAGCAGACAACTCGAGTTGTCTGCTAATATAGTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015288
VALIDATED
PHF15 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 15
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015288.4-1064s21c1
Sequence:CCGGCATCACCAAGATCTCGCATATCTCGAGATATGCGAGATCTTGGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015288.4-1203s21c1
Sequence:CCGGGGCCTGGAAATGCGGACTATACTCGAGTATAGTCCGCATTTCCAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015288.4-586s21c1
Sequence:CCGGGCTATGACTTGGACGAGATTGCTCGAGCAATCTCGTCCAAGTCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_015288.4-1204s1c1
Sequence:CCGGGCCTGGAAATGCGGACTATATCTCGAGATATAGTCCGCATTTCCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015288.4-623s1c1
Sequence:CCGGGCTCATCAACTCGGAGCTTAACTCGAGTTAAGCTCCGAGTTGATGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015288.4-2123s1c1
Sequence:CCGGACGTCGGACATCTTCTCACTTCTCGAGAAGTGAGAAGATGTCCGACGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015288.4-244s1c1
Sequence:CCGGCGACATCTACATCCGCATCAACTCGAGTTGATGCGGATGTAGATGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015288.4-1214s1c1
Sequence:CCGGGCGGACTATATTAGCAGACAACTCGAGTTGTCTGCTAATATAGTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)