EMAIL THIS PAGE TO A FRIEND

PHF16

PHD finger protein 16

153 Gene Product Result for
Synonyms: JADE3
UniProtKB ID: Q92613, Q6IE79
Gene ID:
Human(9767) Summary: This gene is part of a gene cluster on chromosome Xp11.23. The encoded protein contains a zinc finger motif often found in transcriptional regulators, however, its exact function is not known. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(382207) PHD finger protein 16
cow(506664) PHD finger protein 16
sheep(101118166) PHD finger protein 16
Domestic Rabbit(100338938) PHD finger protein 16
naked mole-rat(101713954) PHD finger protein 16
domestic guinea pig(100725258) PHD finger protein 16
Zebrafish(322209) PHD finger protein 16
dog(480892) PHD finger protein 16
Horse(100051026) PHD finger protein 16
domestic cat(101094908) PHD finger protein 16
chicken(418674) PHD finger protein 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199317 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199317 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199317 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014735 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077445 Rosetta Predictions human pricing
NM_014735 Rosetta Predictions human pricing
NM_199317 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312584 predicted 1929
2 SASI_Hs02_00312585 predicted 2355
3 SASI_Hs02_00312586 predicted 642
4 SASI_Hs02_00312587 predicted 1840
5 SASI_Hs02_00312588 predicted 1369
6 SASI_Hs02_00312589 predicted 535
7 SASI_Hs02_00312590 predicted 678
8 SASI_Hs02_00312591 predicted 1006
9 SASI_Hs02_00312592 predicted 2028
10 SASI_Hs02_00312593 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040957 predicted 2178
2 SASI_Hs01_00040960 predicted 2599
3 SASI_Hs01_00040962 predicted 888
4 SASI_Hs01_00040963 predicted 2083
5 SASI_Hs02_00346182 predicted 1619
6 SASI_Hs01_00040964 predicted 774
7 SASI_Hs02_00346183 predicted 922
8 SASI_Hs01_00040965 predicted 1256
9 SASI_Hs01_00040966 predicted 2272
10 SASI_Hs02_00346184 predicted 1229
11 SASI_Hs01_00040958 predicted 926
12 SASI_Hs01_00040959 predicted 480
13 SASI_Hs01_00040961 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199317 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119884 predicted 622
2 SASI_Mm01_00119885 predicted 2205
3 SASI_Mm01_00119887 predicted 1200
4 SASI_Mm01_00119890 predicted 983
5 SASI_Mm02_00351454 predicted 466
6 SASI_Mm01_00119891 predicted 1518
7 SASI_Mm02_00351455 predicted 1314
8 SASI_Mm02_00351456 predicted 2173
9 SASI_Mm01_00119892 predicted 1254
10 SASI_Mm02_00351457 predicted 1802
11 SASI_Mm01_00119883 predicted 1979
12 SASI_Mm01_00119886 predicted 1488
13 SASI_Mm01_00119888 predicted 699
14 SASI_Mm01_00119889 predicted 747
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199317
VALIDATED
PHF16 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199317.1-1753s1c1
Sequence:CCGGCCACTGGATATGAATGTGAAACTCGAGTTTCACATTCATATCCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199317.1-163s1c1
Sequence:CCGGCCTGACTCTCACCATGTTAATCTCGAGATTAACATGGTGAGAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199317.1-482s1c1
Sequence:CCGGGCCCAATTGATGAGACTCTTACTCGAGTAAGAGTCTCATCAATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199317.1-2275s1c1
Sequence:CCGGGCTTCATATCAGGAAACTGATCTCGAGATCAGTTTCCTGATATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199317.1-1579s1c1
Sequence:CCGGGCACTAGAGAACTCACTGTTTCTCGAGAAACAGTGAGTTCTCTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199317
VALIDATED
PHF16 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199317.1-1753s1c1
Sequence:CCGGCCACTGGATATGAATGTGAAACTCGAGTTTCACATTCATATCCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199317.1-163s1c1
Sequence:CCGGCCTGACTCTCACCATGTTAATCTCGAGATTAACATGGTGAGAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199317.1-482s1c1
Sequence:CCGGGCCCAATTGATGAGACTCTTACTCGAGTAAGAGTCTCATCAATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199317.1-2275s1c1
Sequence:CCGGGCTTCATATCAGGAAACTGATCTCGAGATCAGTTTCCTGATATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199317.1-1579s1c1
Sequence:CCGGGCACTAGAGAACTCACTGTTTCTCGAGAAACAGTGAGTTCTCTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199317
VALIDATED
PHF16 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199317.1-1753s1c1
Sequence:CCGGCCACTGGATATGAATGTGAAACTCGAGTTTCACATTCATATCCAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199317.1-163s1c1
Sequence:CCGGCCTGACTCTCACCATGTTAATCTCGAGATTAACATGGTGAGAGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199317.1-482s1c1
Sequence:CCGGGCCCAATTGATGAGACTCTTACTCGAGTAAGAGTCTCATCAATTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199317.1-2275s1c1
Sequence:CCGGGCTTCATATCAGGAAACTGATCTCGAGATCAGTTTCCTGATATGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199317.1-1579s1c1
Sequence:CCGGGCACTAGAGAACTCACTGTTTCTCGAGAAACAGTGAGTTCTCTAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014735
VALIDATED
PHF16 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 16
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014735.2-2007s1c1
Sequence:CCGGGCTCATCTGTTCACAGTATAACTCGAGTTATACTGTGAACAGATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_014735.3-475s21c1
Sequence:CCGGCATTAATCCTGATAGCTATTACTCGAGTAATAGCTATCAGGATTAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014735.2-1098s1c1
Sequence:CCGGCCACCAAGACAGGGACTAAATCTCGAGATTTAGTCCCTGTCTTGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014735.2-2630s1c1
Sequence:CCGGGCAGAAAGTGATGGGAATAAACTCGAGTTTATTCCCATCACTTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014735.2-2086s1c1
Sequence:CCGGCCCACTAGAGAGCAAGAATAACTCGAGTTATTCTTGCTCTCTAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014735.2-781s1c1
Sequence:CCGGGCCAGTTGATGAGAATCTTATCTCGAGATAAGATTCTCATCAACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014735.3-3039s21c1
Sequence:CCGGGGGCAGCTTTCCGGTTATATACTCGAGTATATAACCGGAAAGCTGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_014735.3-1261s21c1
Sequence:CCGGTTGTATTCAGTGCTCTATAAACTCGAGTTTATAGAGCACTGAATACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014735
VALIDATED
PHF16 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 16
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014735.2-2007s1c1
Sequence:CCGGGCTCATCTGTTCACAGTATAACTCGAGTTATACTGTGAACAGATGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_014735.3-475s21c1
Sequence:CCGGCATTAATCCTGATAGCTATTACTCGAGTAATAGCTATCAGGATTAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014735.2-1098s1c1
Sequence:CCGGCCACCAAGACAGGGACTAAATCTCGAGATTTAGTCCCTGTCTTGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014735.2-2630s1c1
Sequence:CCGGGCAGAAAGTGATGGGAATAAACTCGAGTTTATTCCCATCACTTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014735.2-2086s1c1
Sequence:CCGGCCCACTAGAGAGCAAGAATAACTCGAGTTATTCTTGCTCTCTAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014735.2-781s1c1
Sequence:CCGGGCCAGTTGATGAGAATCTTATCTCGAGATAAGATTCTCATCAACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014735.3-3039s21c1
Sequence:CCGGGGGCAGCTTTCCGGTTATATACTCGAGTATATAACCGGAAAGCTGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_014735.3-1261s21c1
Sequence:CCGGTTGTATTCAGTGCTCTATAAACTCGAGTTTATAGAGCACTGAATACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014735
VALIDATED
PHF16 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 16
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014735.2-2007s1c1
Sequence:CCGGGCTCATCTGTTCACAGTATAACTCGAGTTATACTGTGAACAGATGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_014735.3-475s21c1
Sequence:CCGGCATTAATCCTGATAGCTATTACTCGAGTAATAGCTATCAGGATTAATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014735.2-1098s1c1
Sequence:CCGGCCACCAAGACAGGGACTAAATCTCGAGATTTAGTCCCTGTCTTGGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014735.2-2630s1c1
Sequence:CCGGGCAGAAAGTGATGGGAATAAACTCGAGTTTATTCCCATCACTTTCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014735.2-2086s1c1
Sequence:CCGGCCCACTAGAGAGCAAGAATAACTCGAGTTATTCTTGCTCTCTAGTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014735.2-781s1c1
Sequence:CCGGGCCAGTTGATGAGAATCTTATCTCGAGATAAGATTCTCATCAACTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014735.3-3039s21c1
Sequence:CCGGGGGCAGCTTTCCGGTTATATACTCGAGTATATAACCGGAAAGCTGCCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_014735.3-1261s21c1
Sequence:CCGGTTGTATTCAGTGCTCTATAAACTCGAGTTTATAGAGCACTGAATACAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)