EMAIL THIS PAGE TO A FRIEND

PHF17

PHD finger protein 17

297 Gene Product Result for
Synonyms: JADE1
Gene ID:
Mouse(269424) PHD finger protein 17
Rat(310352) PHD finger protein 17
Zebrafish(327437) PHD finger protein 17
chicken(422502) PHD finger protein 17
Horse(100071849) PHD finger protein 17
domestic cat(101081978) PHD finger protein 17
dog(483830) PHD finger protein 17
domestic guinea pig(100723675) PHD finger protein 17
naked mole-rat(101702228) PHD finger protein 17
Domestic Rabbit(100347258) PHD finger protein 17
cow(509264) PHD finger protein 17
sheep(101119334) PHD finger protein 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA020016 Anti-JADE1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunohistochemistry, western blot pricing
AV34715 Anti-PHF17 (AB1) antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, chicken, bovine, rat, human, zebrafish,
western blot pricing
AV34760 Anti-PHF17 (AB2) antibody produced in rabbit affinity isolated antibody mouse, dog, guinea pig, horse, human, rat, rabbit, bovine
western blot pricing
SAB1407998 Anti-PHF17 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2107916 Anti-PHF17 antibody produced in rabbit affinity isolated antibody human, horse, rabbit, bovine, rat, mouse, guinea pig, dog
immunohistochemistry, western blot pricing
SAB2104330 Anti-PHF17 antibody produced in rabbit affinity isolated antibody human, guinea pig, bovine, mouse, dog, rabbit, rat, horse
western blot pricing
SAB2105085 Anti-PHF17, (N-terminal) antibody produced in rabbit affinity isolated antibody rabbit, human, mouse, dog, rat, guinea pig, bovine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024900 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172303 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172303 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172303 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155101 MISSION® esiRNA esiRNA human PHF17 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024900 Rosetta Predictions human pricing
NM_199320 Rosetta Predictions human pricing
NM_001107670 Rosetta Predictions rat pricing
NM_001130184 Rosetta Predictions mouse pricing
NM_001130185 Rosetta Predictions mouse pricing
NM_001130186 Rosetta Predictions mouse pricing
NM_172303 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061311 predicted 974
2 SASI_Hs01_00061313 predicted 884
3 SASI_Hs01_00061314 predicted 1347
4 SASI_Hs01_00061315 predicted 590
5 SASI_Hs02_00357498 predicted 413
6 SASI_Hs01_00061316 predicted 1069
7 SASI_Hs01_00061317 predicted 813
8 SASI_Hs02_00357499 predicted 466
9 SASI_Hs01_00061319 predicted 1106
10 SASI_Hs01_00061320 predicted 611
11 SASI_Hs01_00061312 predicted 1286
12 SASI_Hs01_00061318 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040787 predicted 977
2 SASI_Hs01_00040789 predicted 881
3 SASI_Hs01_00040790 predicted 1348
4 SASI_Hs01_00040791 predicted 597
5 SASI_Hs02_00372727 predicted 409
6 SASI_Hs01_00040792 predicted 1078
7 SASI_Hs01_00040793 predicted 813
8 SASI_Hs02_00372728 predicted 464
9 SASI_Hs01_00040795 predicted 1110
10 SASI_Hs01_00040796 predicted 609
11 SASI_Hs01_00040788 predicted 1082
12 SASI_Hs01_00040794 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231115 predicted 1885
2 SASI_Rn02_00231116 predicted 823
3 SASI_Rn02_00231117 predicted 1991
4 SASI_Rn02_00231118 predicted 550
5 SASI_Rn02_00231119 predicted 2034
6 SASI_Rn02_00231120 predicted 1818
7 SASI_Rn02_00231121 predicted 673
8 SASI_Rn02_00231122 predicted 683
9 SASI_Rn02_00231123 predicted 1012
10 SASI_Rn02_00231124 predicted 1695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311048 predicted 890
2 SASI_Mm02_00311049 predicted 1816
3 SASI_Mm02_00311050 predicted 1835
4 SASI_Mm02_00311051 predicted 653
5 SASI_Mm02_00311052 predicted 2036
6 SASI_Mm02_00311053 predicted 1802
7 SASI_Mm02_00311054 predicted 1449
8 SASI_Mm02_00311055 predicted 666
9 SASI_Mm02_00311056 predicted 1158
10 SASI_Mm02_00311057 predicted 1860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311058 predicted 977
2 SASI_Mm02_00311059 predicted 1896
3 SASI_Mm02_00311060 predicted 1917
4 SASI_Mm02_00311061 predicted 728
5 SASI_Mm02_00311062 predicted 2110
6 SASI_Mm02_00311063 predicted 1885
7 SASI_Mm02_00311064 predicted 1525
8 SASI_Mm02_00311065 predicted 741
9 SASI_Mm02_00311066 predicted 1237
10 SASI_Mm02_00311067 predicted 1943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311068 predicted 930
2 SASI_Mm02_00311069 predicted 1853
3 SASI_Mm02_00311070 predicted 1870
4 SASI_Mm02_00311071 predicted 693
5 SASI_Mm02_00311072 predicted 2071
6 SASI_Mm02_00311073 predicted 1848
7 SASI_Mm02_00311074 predicted 1487
8 SASI_Mm02_00311075 predicted 696
9 SASI_Mm02_00311076 predicted 1195
10 SASI_Mm02_00311077 predicted 1901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343797 predicted 989
2 SASI_Mm01_00133402 predicted 1918
3 SASI_Mm01_00133403 predicted 1933
4 SASI_Mm01_00133404 predicted 747
5 SASI_Mm01_00133405 predicted 2133
6 SASI_Mm01_00133406 predicted 1902
7 SASI_Mm01_00133407 predicted 1543
8 SASI_Mm01_00133408 predicted 762
9 SASI_Mm01_00133409 predicted 1253
10 SASI_Mm01_00133410 predicted 1965
11 SASI_Mm01_00133411 predicted 1804
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024900
VALIDATED
PHF17 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 17
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024900.3-471s21c1
Sequence:CCGGTGAATCCGGATGAGTACTATGCTCGAGCATAGTACTCATCCGGATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024900.3-818s21c1
Sequence:CCGGCAGCGATGCTACGACAATATGCTCGAGCATATTGTCGTAGCATCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024900.2-750s1c1
Sequence:CCGGCGACAATATGAATCATGCCATCTCGAGATGGCATGATTCATATTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024900.2-258s1c1
Sequence:CCGGGTCAACTACTTGGTCCCAGAACTCGAGTTCTGGGACCAAGTAGTTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_024900.2-1527s1c1
Sequence:CCGGGCCTGAGGAAGTAGTGGATTTCTCGAGAAATCCACTACTTCCTCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_024900.2-738s1c1
Sequence:CCGGGCAGCGATGCTACGACAATATCTCGAGATATTGTCGTAGCATCGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_024900.2-1639s1c1
Sequence:CCGGCGGGAGCAGGATGTCTTATTTCTCGAGAAATAAGACATCCTGCTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024900.3-2295s21c1
Sequence:CCGGACTTTGTTTCTTGGGTAATTCCTCGAGGAATTACCCAAGAAACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024900
VALIDATED
PHF17 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 17
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024900.3-471s21c1
Sequence:CCGGTGAATCCGGATGAGTACTATGCTCGAGCATAGTACTCATCCGGATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024900.3-818s21c1
Sequence:CCGGCAGCGATGCTACGACAATATGCTCGAGCATATTGTCGTAGCATCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024900.2-750s1c1
Sequence:CCGGCGACAATATGAATCATGCCATCTCGAGATGGCATGATTCATATTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024900.2-258s1c1
Sequence:CCGGGTCAACTACTTGGTCCCAGAACTCGAGTTCTGGGACCAAGTAGTTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_024900.2-1527s1c1
Sequence:CCGGGCCTGAGGAAGTAGTGGATTTCTCGAGAAATCCACTACTTCCTCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_024900.2-738s1c1
Sequence:CCGGGCAGCGATGCTACGACAATATCTCGAGATATTGTCGTAGCATCGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_024900.2-1639s1c1
Sequence:CCGGCGGGAGCAGGATGTCTTATTTCTCGAGAAATAAGACATCCTGCTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024900.3-2295s21c1
Sequence:CCGGACTTTGTTTCTTGGGTAATTCCTCGAGGAATTACCCAAGAAACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024900
VALIDATED
PHF17 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 17
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024900.3-471s21c1
Sequence:CCGGTGAATCCGGATGAGTACTATGCTCGAGCATAGTACTCATCCGGATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_024900.3-818s21c1
Sequence:CCGGCAGCGATGCTACGACAATATGCTCGAGCATATTGTCGTAGCATCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024900.2-750s1c1
Sequence:CCGGCGACAATATGAATCATGCCATCTCGAGATGGCATGATTCATATTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024900.2-258s1c1
Sequence:CCGGGTCAACTACTTGGTCCCAGAACTCGAGTTCTGGGACCAAGTAGTTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_024900.2-1527s1c1
Sequence:CCGGGCCTGAGGAAGTAGTGGATTTCTCGAGAAATCCACTACTTCCTCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_024900.2-738s1c1
Sequence:CCGGGCAGCGATGCTACGACAATATCTCGAGATATTGTCGTAGCATCGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_024900.2-1639s1c1
Sequence:CCGGCGGGAGCAGGATGTCTTATTTCTCGAGAAATAAGACATCCTGCTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024900.3-2295s21c1
Sequence:CCGGACTTTGTTTCTTGGGTAATTCCTCGAGGAATTACCCAAGAAACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172303
VALIDATED
PHF17 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 17
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172303.4-2781s21c1
Sequence:CCGGGCAAGCAAATACCCATTGTTTCTCGAGAAACAATGGGTATTTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172303.4-2627s21c1
Sequence:CCGGGCGAGGCATCAGAGAAGAAATCTCGAGATTTCTTCTCTGATGCCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172303.4-2131s21c1
Sequence:CCGGCGTCTCCTATCATCAGCACAACTCGAGTTGTGCTGATGATAGGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172303.4-754s21c1
Sequence:CCGGCGATGCTATGACAATATGAATCTCGAGATTCATATTGTCATAGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172303.4-2384s21c1
Sequence:CCGGCCCTAGTCAAAGTGCCTATAACTCGAGTTATAGGCACTTTGACTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172303.3-2200s1c1
Sequence:CCGGCCCTAGTCAAAGTGCCTATAACTCGAGTTATAGGCACTTTGACTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172303.3-570s1c1
Sequence:CCGGCGATGCTATGACAATATGAATCTCGAGATTCATATTGTCATAGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172303.3-2443s1c1
Sequence:CCGGGCGAGGCATCAGAGAAGAAATCTCGAGATTTCTTCTCTGATGCCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172303.3-2597s1c1
Sequence:CCGGGCAAGCAAATACCCATTGTTTCTCGAGAAACAATGGGTATTTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172303.3-1947s1c1
Sequence:CCGGCGTCTCCTATCATCAGCACAACTCGAGTTGTGCTGATGATAGGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172303
VALIDATED
PHF17 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 17
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172303.4-2781s21c1
Sequence:CCGGGCAAGCAAATACCCATTGTTTCTCGAGAAACAATGGGTATTTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172303.4-2627s21c1
Sequence:CCGGGCGAGGCATCAGAGAAGAAATCTCGAGATTTCTTCTCTGATGCCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172303.4-2131s21c1
Sequence:CCGGCGTCTCCTATCATCAGCACAACTCGAGTTGTGCTGATGATAGGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172303.4-754s21c1
Sequence:CCGGCGATGCTATGACAATATGAATCTCGAGATTCATATTGTCATAGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172303.4-2384s21c1
Sequence:CCGGCCCTAGTCAAAGTGCCTATAACTCGAGTTATAGGCACTTTGACTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172303.3-2200s1c1
Sequence:CCGGCCCTAGTCAAAGTGCCTATAACTCGAGTTATAGGCACTTTGACTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172303.3-570s1c1
Sequence:CCGGCGATGCTATGACAATATGAATCTCGAGATTCATATTGTCATAGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172303.3-2443s1c1
Sequence:CCGGGCGAGGCATCAGAGAAGAAATCTCGAGATTTCTTCTCTGATGCCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172303.3-2597s1c1
Sequence:CCGGGCAAGCAAATACCCATTGTTTCTCGAGAAACAATGGGTATTTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172303.3-1947s1c1
Sequence:CCGGCGTCTCCTATCATCAGCACAACTCGAGTTGTGCTGATGATAGGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172303
VALIDATED
PHF17 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 17
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172303.4-2781s21c1
Sequence:CCGGGCAAGCAAATACCCATTGTTTCTCGAGAAACAATGGGTATTTGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172303.4-2627s21c1
Sequence:CCGGGCGAGGCATCAGAGAAGAAATCTCGAGATTTCTTCTCTGATGCCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172303.4-2131s21c1
Sequence:CCGGCGTCTCCTATCATCAGCACAACTCGAGTTGTGCTGATGATAGGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172303.4-754s21c1
Sequence:CCGGCGATGCTATGACAATATGAATCTCGAGATTCATATTGTCATAGCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172303.4-2384s21c1
Sequence:CCGGCCCTAGTCAAAGTGCCTATAACTCGAGTTATAGGCACTTTGACTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172303.3-2200s1c1
Sequence:CCGGCCCTAGTCAAAGTGCCTATAACTCGAGTTATAGGCACTTTGACTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172303.3-570s1c1
Sequence:CCGGCGATGCTATGACAATATGAATCTCGAGATTCATATTGTCATAGCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172303.3-2443s1c1
Sequence:CCGGGCGAGGCATCAGAGAAGAAATCTCGAGATTTCTTCTCTGATGCCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172303.3-2597s1c1
Sequence:CCGGGCAAGCAAATACCCATTGTTTCTCGAGAAACAATGGGTATTTGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172303.3-1947s1c1
Sequence:CCGGCGTCTCCTATCATCAGCACAACTCGAGTTGTGCTGATGATAGGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)