EMAIL THIS PAGE TO A FRIEND

PHF19

PHD finger protein 19

160 Gene Product Result for
Synonyms: MTF2L1 PCL3 TDRD19B
UniProtKB ID: Q5T6S3, Q32NF2, Q5T6S4, Q6N038, Q8TBL6, Q9UFS9
Gene ID:
Mouse(74016) PHD finger protein 19
Rat(296653) PHD finger protein 19
cow(532056) PHD finger protein 19
sheep(101115767) PHD finger protein 19
naked mole-rat(101711409) PHD finger protein 19
domestic guinea pig(100723413) PHD finger protein 19
chicken(772213) PHD finger protein 19
Horse(100071777) PHD finger protein 19
domestic cat(101087180) PHD finger protein 19
dog(100688884) PHD finger protein 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015651 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015651 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015651 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028716 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028716 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028716 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009936 Rosetta Predictions human pricing
NM_015651 Rosetta Predictions human pricing
NM_001106570 Rosetta Predictions rat pricing
NM_028716 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222696 predicted 493
2 SASI_Hs01_00222697 predicted 460
3 SASI_Hs01_00222698 predicted 404
4 SASI_Hs01_00222699 predicted 408
5 SASI_Hs01_00222700 predicted 349
6 SASI_Hs01_00222701 predicted 451
7 SASI_Hs02_00305738 predicted 488
8 SASI_Hs02_00305739 predicted 449
9 SASI_Hs01_00222703 predicted 459
10 SASI_Hs01_00222704 predicted 342
11 SASI_Hs01_00222702 predicted 402
12 SASI_Hs01_00222705 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092207 predicted 492
2 SASI_Hs01_00092208 predicted 455
3 SASI_Hs01_00092209 predicted 408
4 SASI_Hs01_00092210 predicted 405
5 SASI_Hs01_00092211 predicted 350
6 SASI_Hs01_00092212 predicted 458
7 SASI_Hs02_00348257 predicted 490
8 SASI_Hs02_00348258 predicted 451
9 SASI_Hs01_00092214 predicted 455
10 SASI_Hs01_00092215 predicted 339
11 SASI_Hs01_00092213 predicted 397
12 SASI_Hs01_00092216 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106570 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220258 predicted 859
2 SASI_Rn02_00220259 predicted 660
3 SASI_Rn02_00220260 predicted 1636
4 SASI_Rn02_00220261 predicted 197
5 SASI_Rn02_00220262 predicted 785
6 SASI_Rn02_00220263 predicted 726
7 SASI_Rn02_00220264 predicted 1118
8 SASI_Rn02_00220265 predicted 780
9 SASI_Rn02_00220266 predicted 839
10 SASI_Rn02_00220267 predicted 1320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334261 predicted 868
2 SASI_Mm01_00030060 predicted 965
3 SASI_Mm01_00030063 predicted 953
4 SASI_Mm01_00030064 predicted 767
5 SASI_Mm01_00030065 predicted 830
6 SASI_Mm01_00030066 predicted 603
7 SASI_Mm01_00030067 predicted 357
8 SASI_Mm01_00030068 predicted 1307
9 SASI_Mm02_00334262 predicted 817
10 SASI_Mm01_00030069 predicted 1640
11 SASI_Mm01_00030061 predicted 758
12 SASI_Mm01_00030062 predicted 722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015651
PHF19 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 19
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015651.1-463s1c1
Sequence:CCGGCCTCGTGACTTTCGAAGATAACTCGAGTTATCTTCGAAAGTCACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015651.1-1851s1c1
Sequence:CCGGCCCACCTCAAGTCATCTATCACTCGAGTGATAGATGACTTGAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015651.1-464s21c1
Sequence:CCGGCTCGTGACTTTCGAAGATAATCTCGAGATTATCTTCGAAAGTCACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015651.1-3188s1c1
Sequence:CCGGCCTGAAATGGACAATCACTTTCTCGAGAAAGTGATTGTCCATTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015651.1-1507s1c1
Sequence:CCGGCCTGGCTAGCATATTTGACTTCTCGAGAAGTCAAATATGCTAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015651.1-1809s1c1
Sequence:CCGGGCCACACATTTGAGAGCATCACTCGAGTGATGCTCTCAAATGTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015651.1-1503s21c1
Sequence:CCGGACCACCTGGCTAGCATATTTGCTCGAGCAAATATGCTAGCCAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015651.1-1195s21c1
Sequence:CCGGCAACGCTCTGAACAGTTATAACTCGAGTTATAACTGTTCAGAGCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015651
PHF19 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 19
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015651.1-463s1c1
Sequence:CCGGCCTCGTGACTTTCGAAGATAACTCGAGTTATCTTCGAAAGTCACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015651.1-1851s1c1
Sequence:CCGGCCCACCTCAAGTCATCTATCACTCGAGTGATAGATGACTTGAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015651.1-464s21c1
Sequence:CCGGCTCGTGACTTTCGAAGATAATCTCGAGATTATCTTCGAAAGTCACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015651.1-3188s1c1
Sequence:CCGGCCTGAAATGGACAATCACTTTCTCGAGAAAGTGATTGTCCATTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015651.1-1507s1c1
Sequence:CCGGCCTGGCTAGCATATTTGACTTCTCGAGAAGTCAAATATGCTAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015651.1-1809s1c1
Sequence:CCGGGCCACACATTTGAGAGCATCACTCGAGTGATGCTCTCAAATGTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015651.1-1503s21c1
Sequence:CCGGACCACCTGGCTAGCATATTTGCTCGAGCAAATATGCTAGCCAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015651.1-1195s21c1
Sequence:CCGGCAACGCTCTGAACAGTTATAACTCGAGTTATAACTGTTCAGAGCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015651
PHF19 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 19
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015651.1-463s1c1
Sequence:CCGGCCTCGTGACTTTCGAAGATAACTCGAGTTATCTTCGAAAGTCACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015651.1-1851s1c1
Sequence:CCGGCCCACCTCAAGTCATCTATCACTCGAGTGATAGATGACTTGAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015651.1-464s21c1
Sequence:CCGGCTCGTGACTTTCGAAGATAATCTCGAGATTATCTTCGAAAGTCACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015651.1-3188s1c1
Sequence:CCGGCCTGAAATGGACAATCACTTTCTCGAGAAAGTGATTGTCCATTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015651.1-1507s1c1
Sequence:CCGGCCTGGCTAGCATATTTGACTTCTCGAGAAGTCAAATATGCTAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015651.1-1809s1c1
Sequence:CCGGGCCACACATTTGAGAGCATCACTCGAGTGATGCTCTCAAATGTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015651.1-1503s21c1
Sequence:CCGGACCACCTGGCTAGCATATTTGCTCGAGCAAATATGCTAGCCAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015651.1-1195s21c1
Sequence:CCGGCAACGCTCTGAACAGTTATAACTCGAGTTATAACTGTTCAGAGCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028716
VALIDATED
PHF19 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 19
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028716.1-193s1c1
Sequence:CCGGCGGGCTATATTACCTTGGCAACTCGAGTTGCCAAGGTAATATAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028716.1-2788s1c1
Sequence:CCGGCCCTTCAGAAAGGAAGGCTTTCTCGAGAAAGCCTTCCTTTCTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028716.1-1639s1c1
Sequence:CCGGCCTCAAGTCCTCTATCACCAACTCGAGTTGGTGATAGAGGACTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028716.1-1291s1c1
Sequence:CCGGCCTAGCCAGTATATTCGACTTCTCGAGAAGTCGAATATACTGGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028716.1-836s1c1
Sequence:CCGGGCTCTCTATAACTTGGGAGTACTCGAGTACTCCCAAGTTATAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028716
VALIDATED
PHF19 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 19
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028716.1-193s1c1
Sequence:CCGGCGGGCTATATTACCTTGGCAACTCGAGTTGCCAAGGTAATATAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028716.1-2788s1c1
Sequence:CCGGCCCTTCAGAAAGGAAGGCTTTCTCGAGAAAGCCTTCCTTTCTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028716.1-1639s1c1
Sequence:CCGGCCTCAAGTCCTCTATCACCAACTCGAGTTGGTGATAGAGGACTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028716.1-1291s1c1
Sequence:CCGGCCTAGCCAGTATATTCGACTTCTCGAGAAGTCGAATATACTGGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028716.1-836s1c1
Sequence:CCGGGCTCTCTATAACTTGGGAGTACTCGAGTACTCCCAAGTTATAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028716
VALIDATED
PHF19 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 19
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028716.1-193s1c1
Sequence:CCGGCGGGCTATATTACCTTGGCAACTCGAGTTGCCAAGGTAATATAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028716.1-2788s1c1
Sequence:CCGGCCCTTCAGAAAGGAAGGCTTTCTCGAGAAAGCCTTCCTTTCTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028716.1-1639s1c1
Sequence:CCGGCCTCAAGTCCTCTATCACCAACTCGAGTTGGTGATAGAGGACTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028716.1-1291s1c1
Sequence:CCGGCCTAGCCAGTATATTCGACTTCTCGAGAAGTCGAATATACTGGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028716.1-836s1c1
Sequence:CCGGGCTCTCTATAACTTGGGAGTACTCGAGTACTCCCAAGTTATAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)