EMAIL THIS PAGE TO A FRIEND

PHF1

PHD finger protein 1

122 Gene Product Result for
Synonyms: MTF2L2 PCL1 PHF2 TDRD19C hPHF1
Gene ID:
Human(5252) Summary: This gene encodes a Polycomb group protein. The protein is a component of a histone H3 lysine-27 (H3K27)-specific methyltransferase complex, and functions in transcriptional repression of homeotic genes. The protein is also recruited to double-strand breaks, and reduced protein levels results in X-ray sensitivity and increased homologous recombination. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Mouse(21652) PHD finger protein 1
Rat(294287) PHD finger protein 1
Thale Cress(824384) SEC12-like protein 1
Horse(100061619) PHD finger protein 1
dog(481741) PHD finger protein 1
domestic cat(101092270) PHD finger protein 1
domestic guinea pig(100729738) PHD finger protein 1
Domestic Rabbit(100346719) PHD finger protein 1
naked mole-rat(101713089) PHD finger protein 1
cow(508957) PHD finger protein 1
sheep(101113630) PHD finger protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV39588 Anti-PHF1 (AB1) antibody produced in rabbit affinity isolated antibody bovine, guinea pig, rabbit, canine, horse, human
western blot pricing
AV39589 Anti-PHF1 (AB2) antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, rat, bovine, mouse, human, canine, horse
immunohistochemistry, western blot pricing
SAB1412545 ANTI-PHF1 antibody produced in mouse clone 4D8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412546 ANTI-PHF1 antibody produced in mouse clone 2A12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412547 ANTI-PHF1 antibody produced in mouse clone 4F5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2107899 Anti-PHF1 antibody produced in rabbit IgG fraction of antiserum guinea pig, human, rat, rabbit, bovine, pig, mouse, horse, canine
immunohistochemistry, western blot pricing
HPA031038 Anti-PHF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502188 Anti-PHF1 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
WH0005252M1 Monoclonal Anti-PHF1 antibody produced in mouse clone 2D3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404198 Monoclonal Anti-PHF1 antibody produced in mouse clone 2G7, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002636 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009343 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009343 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009343 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002636 Rosetta Predictions human pricing
NM_024165 Rosetta Predictions human pricing
NM_212538 Rosetta Predictions rat pricing
NM_009343 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109692 predicted 597
2 SASI_Hs01_00109693 predicted 370
3 SASI_Hs01_00109696 predicted 213
4 SASI_Hs01_00109697 predicted 807
5 SASI_Hs01_00109698 predicted 847
6 SASI_Hs01_00109699 predicted 224
7 SASI_Hs02_00334159 predicted 739
8 SASI_Hs01_00109700 predicted 444
9 SASI_Hs01_00109701 predicted 834
10 SASI_Hs02_00334160 predicted 364
11 SASI_Hs01_00109694 predicted 263
12 SASI_Hs01_00109695 predicted 1603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195063 predicted 760
2 SASI_Hs01_00195064 predicted 537
3 SASI_Hs01_00195067 predicted 374
4 SASI_Hs01_00195068 predicted 977
5 SASI_Hs01_00195069 predicted 1008
6 SASI_Hs01_00195070 predicted 383
7 SASI_Hs02_00356620 predicted 896
8 SASI_Hs01_00195071 predicted 608
9 SASI_Hs01_00195072 predicted 991
10 SASI_Hs02_00356621 predicted 528
11 SASI_Hs01_00195065 predicted 419
12 SASI_Hs01_00195066 predicted 1866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078475 predicted 756
2 SASI_Rn01_00078476 predicted 1147
3 SASI_Rn01_00078477 predicted 898
4 SASI_Rn02_00270559 predicted 937
5 SASI_Rn01_00078478 predicted 968
6 SASI_Rn02_00270560 predicted 893
7 SASI_Rn01_00078479 predicted 690
8 SASI_Rn01_00078480 predicted 1839
9 SASI_Rn01_00078481 predicted 1665
10 SASI_Rn01_00078482 predicted 1457
11 SASI_Rn01_00078483 predicted 385
12 SASI_Rn01_00078484 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140159 predicted 529
2 SASI_Mm01_00140161 predicted 1664
3 SASI_Mm01_00140163 predicted 1351
4 SASI_Mm02_00315923 predicted 1354
5 SASI_Mm02_00315924 predicted 550
6 SASI_Mm01_00140165 predicted 1103
7 SASI_Mm01_00140166 predicted 580
8 SASI_Mm01_00140167 predicted 620
9 SASI_Mm01_00140168 predicted 1215
10 SASI_Mm02_00315925 predicted 824
11 SASI_Mm01_00140160 predicted 343
12 SASI_Mm01_00140162 predicted 355
13 SASI_Mm01_00140164 predicted 1003
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002636
VALIDATED
PHF1 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002636.4-440s21c1
Sequence:CCGGTTCGCAGTTTCTGGTTCTATGCTCGAGCATAGAACCAGAAACTGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002636.3-730s21c1
Sequence:CCGGGGGACAGGTTCTATGAATTTGCTCGAGCAAATTCATAGAACCTGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002636.3-1682s21c1
Sequence:CCGGCACACACCGGCACTTTCATACCTCGAGGTATGAAAGTGCCGGTGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002636.3-985s21c1
Sequence:CCGGGCCACAAGGACCGTTTCATTTCTCGAGAAATGAAACGGTCCTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002636.3-962s21c1
Sequence:CCGGCAAGCTCCTCTCTGCTCTTAACTCGAGTTAAGAGCAGAGAGGAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002636.3-229s21c1
Sequence:CCGGAGGTGTGTCTGGTCCAGTTTGCTCGAGCAAACTGGACCAGACACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002636.4-356s21c1
Sequence:CCGGATGGACTGATGGGCTGCTATACTCGAGTATAGCAGCCCATCAGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002636.4-1900s21c1
Sequence:CCGGTCACCTACAGCTGGGATGTACCTCGAGGTACATCCCAGCTGTAGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019184    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002636.3-1853s1c1
Sequence:CCGGCCCATTTCCTTTGATGTTATTCTCGAGAATAACATCAAAGGAAATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002636.3-836s1c1
Sequence:CCGGCCTCAGTGTTTGCTGTAAGAACTCGAGTTCTTACAGCAAACACTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002636.3-1369s1c1
Sequence:CCGGCCTGGAACTTCACATTGGTTTCTCGAGAAACCAATGTGAAGTTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002636.3-185s1c1
Sequence:CCGGGCTGCTATACTTGGGTACCATCTCGAGATGGTACCCAAGTATAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002636.3-255s1c1
Sequence:CCGGGATTCGCAGTTTCTGGTTCTACTCGAGTAGAACCAGAAACTGCGAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002636
VALIDATED
PHF1 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002636.4-440s21c1
Sequence:CCGGTTCGCAGTTTCTGGTTCTATGCTCGAGCATAGAACCAGAAACTGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002636.3-730s21c1
Sequence:CCGGGGGACAGGTTCTATGAATTTGCTCGAGCAAATTCATAGAACCTGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002636.3-1682s21c1
Sequence:CCGGCACACACCGGCACTTTCATACCTCGAGGTATGAAAGTGCCGGTGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002636.3-985s21c1
Sequence:CCGGGCCACAAGGACCGTTTCATTTCTCGAGAAATGAAACGGTCCTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002636.3-962s21c1
Sequence:CCGGCAAGCTCCTCTCTGCTCTTAACTCGAGTTAAGAGCAGAGAGGAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002636.3-229s21c1
Sequence:CCGGAGGTGTGTCTGGTCCAGTTTGCTCGAGCAAACTGGACCAGACACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002636.4-356s21c1
Sequence:CCGGATGGACTGATGGGCTGCTATACTCGAGTATAGCAGCCCATCAGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002636.4-1900s21c1
Sequence:CCGGTCACCTACAGCTGGGATGTACCTCGAGGTACATCCCAGCTGTAGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019184    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002636.3-1853s1c1
Sequence:CCGGCCCATTTCCTTTGATGTTATTCTCGAGAATAACATCAAAGGAAATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002636.3-836s1c1
Sequence:CCGGCCTCAGTGTTTGCTGTAAGAACTCGAGTTCTTACAGCAAACACTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002636.3-1369s1c1
Sequence:CCGGCCTGGAACTTCACATTGGTTTCTCGAGAAACCAATGTGAAGTTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002636.3-185s1c1
Sequence:CCGGGCTGCTATACTTGGGTACCATCTCGAGATGGTACCCAAGTATAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002636.3-255s1c1
Sequence:CCGGGATTCGCAGTTTCTGGTTCTACTCGAGTAGAACCAGAAACTGCGAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002636
VALIDATED
PHF1 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002636.4-440s21c1
Sequence:CCGGTTCGCAGTTTCTGGTTCTATGCTCGAGCATAGAACCAGAAACTGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002636.3-730s21c1
Sequence:CCGGGGGACAGGTTCTATGAATTTGCTCGAGCAAATTCATAGAACCTGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002636.3-1682s21c1
Sequence:CCGGCACACACCGGCACTTTCATACCTCGAGGTATGAAAGTGCCGGTGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002636.3-985s21c1
Sequence:CCGGGCCACAAGGACCGTTTCATTTCTCGAGAAATGAAACGGTCCTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002636.3-962s21c1
Sequence:CCGGCAAGCTCCTCTCTGCTCTTAACTCGAGTTAAGAGCAGAGAGGAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002636.3-229s21c1
Sequence:CCGGAGGTGTGTCTGGTCCAGTTTGCTCGAGCAAACTGGACCAGACACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002636.4-356s21c1
Sequence:CCGGATGGACTGATGGGCTGCTATACTCGAGTATAGCAGCCCATCAGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002636.4-1900s21c1
Sequence:CCGGTCACCTACAGCTGGGATGTACCTCGAGGTACATCCCAGCTGTAGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019184    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002636.3-1853s1c1
Sequence:CCGGCCCATTTCCTTTGATGTTATTCTCGAGAATAACATCAAAGGAAATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002636.3-836s1c1
Sequence:CCGGCCTCAGTGTTTGCTGTAAGAACTCGAGTTCTTACAGCAAACACTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002636.3-1369s1c1
Sequence:CCGGCCTGGAACTTCACATTGGTTTCTCGAGAAACCAATGTGAAGTTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002636.3-185s1c1
Sequence:CCGGGCTGCTATACTTGGGTACCATCTCGAGATGGTACCCAAGTATAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002636.3-255s1c1
Sequence:CCGGGATTCGCAGTTTCTGGTTCTACTCGAGTAGAACCAGAAACTGCGAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009343
VALIDATED
PHF1 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009343.2-1095s21c1
Sequence:CCGGTCTACGGAGACAGATTCTATGCTCGAGCATAGAATCTGTCTCCGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009343.2-1373s21c1
Sequence:CCGGATTTCAGGGAGGGAGATTAAACTCGAGTTTAATCTCCCTCCCTGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009343.2-842s21c1
Sequence:CCGGGTCTTTGCAATCGCCACTAAGCTCGAGCTTAGTGGCGATTGCAAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009343.2-919s21c1
Sequence:CCGGCTCCCTGCCATACGGATTAAACTCGAGTTTAATCCGTATGGCAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009343.2-2167s21c1
Sequence:CCGGTCACCTACAGCTGGGATGTACCTCGAGGTACATCCCAGCTGTAGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009343.1-1974s1c1
Sequence:CCGGGCTGGGATGTACCTGGAGAGACTCGAGTCTCTCCAGGTACATCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009343.1-1459s1c1
Sequence:CCGGCCCAGCCCTAACCAGAGCTATCTCGAGATAGCTCTGGTTAGGGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009343.1-1005s1c1
Sequence:CCGGCAGCGTTTGCTGTAAGAAGAACTCGAGTTCTTCTTACAGCAAACGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009343.1-404s1c1
Sequence:CCGGTGGTCCAGTTTGAGGACGATTCTCGAGAATCGTCCTCAAACTGGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009343.1-894s1c1
Sequence:CCGGCGGAGACAGATTCTATGAATTCTCGAGAATTCATAGAATCTGTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009343
VALIDATED
PHF1 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009343.2-1095s21c1
Sequence:CCGGTCTACGGAGACAGATTCTATGCTCGAGCATAGAATCTGTCTCCGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009343.2-1373s21c1
Sequence:CCGGATTTCAGGGAGGGAGATTAAACTCGAGTTTAATCTCCCTCCCTGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009343.2-842s21c1
Sequence:CCGGGTCTTTGCAATCGCCACTAAGCTCGAGCTTAGTGGCGATTGCAAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009343.2-919s21c1
Sequence:CCGGCTCCCTGCCATACGGATTAAACTCGAGTTTAATCCGTATGGCAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009343.2-2167s21c1
Sequence:CCGGTCACCTACAGCTGGGATGTACCTCGAGGTACATCCCAGCTGTAGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009343.1-1974s1c1
Sequence:CCGGGCTGGGATGTACCTGGAGAGACTCGAGTCTCTCCAGGTACATCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009343.1-1459s1c1
Sequence:CCGGCCCAGCCCTAACCAGAGCTATCTCGAGATAGCTCTGGTTAGGGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009343.1-1005s1c1
Sequence:CCGGCAGCGTTTGCTGTAAGAAGAACTCGAGTTCTTCTTACAGCAAACGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009343.1-404s1c1
Sequence:CCGGTGGTCCAGTTTGAGGACGATTCTCGAGAATCGTCCTCAAACTGGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009343.1-894s1c1
Sequence:CCGGCGGAGACAGATTCTATGAATTCTCGAGAATTCATAGAATCTGTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009343
VALIDATED
PHF1 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009343.2-1095s21c1
Sequence:CCGGTCTACGGAGACAGATTCTATGCTCGAGCATAGAATCTGTCTCCGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009343.2-1373s21c1
Sequence:CCGGATTTCAGGGAGGGAGATTAAACTCGAGTTTAATCTCCCTCCCTGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009343.2-842s21c1
Sequence:CCGGGTCTTTGCAATCGCCACTAAGCTCGAGCTTAGTGGCGATTGCAAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009343.2-919s21c1
Sequence:CCGGCTCCCTGCCATACGGATTAAACTCGAGTTTAATCCGTATGGCAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009343.2-2167s21c1
Sequence:CCGGTCACCTACAGCTGGGATGTACCTCGAGGTACATCCCAGCTGTAGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009343.1-1974s1c1
Sequence:CCGGGCTGGGATGTACCTGGAGAGACTCGAGTCTCTCCAGGTACATCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009343.1-1459s1c1
Sequence:CCGGCCCAGCCCTAACCAGAGCTATCTCGAGATAGCTCTGGTTAGGGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009343.1-1005s1c1
Sequence:CCGGCAGCGTTTGCTGTAAGAAGAACTCGAGTTCTTCTTACAGCAAACGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009343.1-404s1c1
Sequence:CCGGTGGTCCAGTTTGAGGACGATTCTCGAGAATCGTCCTCAAACTGGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009343.1-894s1c1
Sequence:CCGGCGGAGACAGATTCTATGAATTCTCGAGAATTCATAGAATCTGTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)