EMAIL THIS PAGE TO A FRIEND

PHF20

PHD finger protein 20

290 Gene Product Result for
Synonyms: C20orf104 GLEA2 HCA58 NZF TDRD20A TZP
Gene ID:
Mouse(228829) PHD finger protein 20
Rat(311575) PHD finger protein 20
cow(529591) PHD finger protein 20
sheep(101119840) PHD finger protein 20
naked mole-rat(101699970) PHD finger protein 20
Domestic Rabbit(100328711) PHD finger protein 20
domestic guinea pig(100735452) PHD finger protein 20
chicken(419131) PHD finger protein 20
Horse(100055019) PHD finger protein 20
domestic cat(101099453) PHD finger protein 20
dog(477217) PHD finger protein 20
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016436 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172674 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172674 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172674 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016436 Rosetta Predictions human pricing
NM_001107795 Rosetta Predictions rat pricing
NM_172674 Rosetta Predictions mouse pricing
XM_133187 Rosetta Predictions mouse pricing
XM_895086 Rosetta Predictions mouse pricing
XM_902645 Rosetta Predictions mouse pricing
XM_902647 Rosetta Predictions mouse pricing
XM_902654 Rosetta Predictions mouse pricing
XM_902658 Rosetta Predictions mouse pricing
XM_921093 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349463 predicted 1097
2 SASI_Hs01_00232157 predicted 2592
3 SASI_Hs01_00232158 predicted 383
4 SASI_Hs01_00232159 predicted 1122
5 SASI_Hs01_00232161 predicted 1067
6 SASI_Hs01_00232162 predicted 538
7 SASI_Hs01_00232163 predicted 2297
8 SASI_Hs02_00349464 predicted 916
9 SASI_Hs01_00232164 predicted 325
10 SASI_Hs01_00232165 predicted 290
11 SASI_Hs01_00232160 predicted 1355
12 SASI_Hs01_00232166 predicted 1053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107795 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232345 predicted 1014
2 SASI_Rn02_00232346 predicted 410
3 SASI_Rn02_00232347 predicted 1389
4 SASI_Rn02_00232348 predicted 608
5 SASI_Rn02_00232349 predicted 627
6 SASI_Rn02_00232350 predicted 1588
7 SASI_Rn02_00232351 predicted 200
8 SASI_Rn02_00232352 predicted 3003
9 SASI_Rn02_00232353 predicted 1216
10 SASI_Rn02_00232354 predicted 2383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172674 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344404 predicted 1198
2 SASI_Mm02_00344405 predicted 1171
3 SASI_Mm02_00344406 predicted 561
4 SASI_Mm02_00344407 predicted 2697
5 SASI_Mm02_00344408 predicted 2655
6 SASI_Mm02_00344409 predicted 1377
7 SASI_Mm02_00344410 predicted 995
8 SASI_Mm02_00344411 predicted 1508
9 SASI_Mm02_00344412 predicted 1213
10 SASI_Mm02_00344413 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270341 predicted 495
2 SASI_Mm01_00270342 predicted 2827
3 SASI_Mm01_00270343 predicted 1106
4 SASI_Mm01_00270344 predicted 2636
5 SASI_Mm01_00270345 predicted 2643
6 SASI_Mm01_00270346 predicted 938
7 SASI_Mm01_00270347 predicted 1446
8 SASI_Mm01_00270348 predicted 502
9 SASI_Mm01_00270349 predicted 449
10 SASI_Mm01_00270350 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206267 predicted 864
2 SASI_Mm01_00206268 predicted 3196
3 SASI_Mm01_00206269 predicted 1486
4 SASI_Mm01_00206270 predicted 3003
5 SASI_Mm01_00206271 predicted 3017
6 SASI_Mm01_00206272 predicted 1316
7 SASI_Mm01_00206273 predicted 1818
8 SASI_Mm01_00206274 predicted 873
9 SASI_Mm01_00206275 predicted 820
10 SASI_Mm01_00206276 predicted 1322
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902645 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275645 predicted 1704
2 SASI_Mm01_00275646 predicted 1656
3 SASI_Mm01_00275647 predicted 1856
4 SASI_Mm01_00275648 predicted 2075
5 SASI_Mm01_00275649 predicted 1838
6 SASI_Mm01_00275650 predicted 2057
7 SASI_Mm01_00275651 predicted 1430
8 SASI_Mm01_00275652 predicted 1886
9 SASI_Mm01_00275653 predicted 1719
10 SASI_Mm01_00275654 predicted 1526
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256380 predicted 2428
2 SASI_Mm01_00256381 predicted 2233
3 SASI_Mm01_00256382 predicted 1115
4 SASI_Mm01_00256383 predicted 2250
5 SASI_Mm01_00256384 predicted 1045
6 SASI_Mm01_00256385 predicted 1886
7 SASI_Mm01_00256386 predicted 1580
8 SASI_Mm01_00256387 predicted 1584
9 SASI_Mm01_00256388 predicted 1898
10 SASI_Mm01_00256389 predicted 2236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229661 predicted 565
2 SASI_Mm01_00229662 predicted 2904
3 SASI_Mm01_00229663 predicted 1187
4 SASI_Mm01_00229664 predicted 2708
5 SASI_Mm01_00229665 predicted 2722
6 SASI_Mm01_00229666 predicted 1009
7 SASI_Mm01_00229667 predicted 1511
8 SASI_Mm01_00229668 predicted 578
9 SASI_Mm01_00229669 predicted 1589
10 SASI_Mm01_00229670 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243198 predicted 403
2 SASI_Mm01_00243199 predicted 499
3 SASI_Mm01_00243200 predicted 367
4 SASI_Mm01_00243201 predicted 519
5 SASI_Mm01_00243202 predicted 403
6 SASI_Mm01_00243203 predicted 401
7 SASI_Mm01_00243204 predicted 414
8 SASI_Mm01_00243205 predicted 363
9 SASI_Mm01_00243206 predicted 462
10 SASI_Mm01_00243207 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_921093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212226 predicted 381
2 SASI_Mm01_00212227 predicted 2715
3 SASI_Mm01_00212228 predicted 998
4 SASI_Mm01_00212229 predicted 2515
5 SASI_Mm01_00212230 predicted 2534
6 SASI_Mm01_00212231 predicted 827
7 SASI_Mm01_00212232 predicted 1327
8 SASI_Mm01_00212233 predicted 385
9 SASI_Mm01_00212234 predicted 342
10 SASI_Mm01_00212235 predicted 842
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016436
VALIDATED
PHF20 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 20
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_016436.3-2153s1c1
Sequence:CCGGCCCGAGAAATACACCTGTTATCTCGAGATAACAGGTGTATTTCTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_016436.3-176s1c1
Sequence:CCGGCCAGCTCACATAGAAGACATTCTCGAGAATGTCTTCTATGTGAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_016436.3-1112s1c1
Sequence:CCGGCCTGACTTGGTTGTATCAGATCTCGAGATCTGATACAACCAAGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_016436.3-2127s1c1
Sequence:CCGGGCATGGGATTACTGGAAGAAACTCGAGTTTCTTCCAGTAATCCCATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_016436.3-668s1c1
Sequence:CCGGCCTGATAAAGAAGGAAAGTTACTCGAGTAACTTTCCTTCTTTATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016436.4-538s21c1
Sequence:GTACCGGGTGGGTAATGCTAGGCCTAAACTCGAGTTTAGGCCTAGCATTACCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016436.4-1929s21c1
Sequence:GTACCGGAGCATTGGAGGAGGATAATTTCTCGAGAAATTATCCTCCTCCAATGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016436.4-3437s21c1
Sequence:GTACCGGATTGTGCCACTGATGATAAACCTCGAGGTTTATCATCAGTGGCACAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016436.4-254s21c1
Sequence:GTACCGGAGCGTTGGAACCATCGTTATGCTCGAGCATAACGATGGTTCCAACGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016436
VALIDATED
PHF20 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 20
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_016436.3-2153s1c1
Sequence:CCGGCCCGAGAAATACACCTGTTATCTCGAGATAACAGGTGTATTTCTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_016436.3-176s1c1
Sequence:CCGGCCAGCTCACATAGAAGACATTCTCGAGAATGTCTTCTATGTGAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_016436.3-1112s1c1
Sequence:CCGGCCTGACTTGGTTGTATCAGATCTCGAGATCTGATACAACCAAGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_016436.3-2127s1c1
Sequence:CCGGGCATGGGATTACTGGAAGAAACTCGAGTTTCTTCCAGTAATCCCATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_016436.3-668s1c1
Sequence:CCGGCCTGATAAAGAAGGAAAGTTACTCGAGTAACTTTCCTTCTTTATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016436.4-538s21c1
Sequence:GTACCGGGTGGGTAATGCTAGGCCTAAACTCGAGTTTAGGCCTAGCATTACCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016436.4-1929s21c1
Sequence:GTACCGGAGCATTGGAGGAGGATAATTTCTCGAGAAATTATCCTCCTCCAATGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016436.4-3437s21c1
Sequence:GTACCGGATTGTGCCACTGATGATAAACCTCGAGGTTTATCATCAGTGGCACAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016436.4-254s21c1
Sequence:GTACCGGAGCGTTGGAACCATCGTTATGCTCGAGCATAACGATGGTTCCAACGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016436
VALIDATED
PHF20 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 20
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_016436.3-2153s1c1
Sequence:CCGGCCCGAGAAATACACCTGTTATCTCGAGATAACAGGTGTATTTCTCGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_016436.3-176s1c1
Sequence:CCGGCCAGCTCACATAGAAGACATTCTCGAGAATGTCTTCTATGTGAGCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_016436.3-1112s1c1
Sequence:CCGGCCTGACTTGGTTGTATCAGATCTCGAGATCTGATACAACCAAGTCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_016436.3-2127s1c1
Sequence:CCGGGCATGGGATTACTGGAAGAAACTCGAGTTTCTTCCAGTAATCCCATGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_016436.3-668s1c1
Sequence:CCGGCCTGATAAAGAAGGAAAGTTACTCGAGTAACTTTCCTTCTTTATCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016436.4-538s21c1
Sequence:GTACCGGGTGGGTAATGCTAGGCCTAAACTCGAGTTTAGGCCTAGCATTACCCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016436.4-1929s21c1
Sequence:GTACCGGAGCATTGGAGGAGGATAATTTCTCGAGAAATTATCCTCCTCCAATGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016436.4-3437s21c1
Sequence:GTACCGGATTGTGCCACTGATGATAAACCTCGAGGTTTATCATCAGTGGCACAATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016436.4-254s21c1
Sequence:GTACCGGAGCGTTGGAACCATCGTTATGCTCGAGCATAACGATGGTTCCAACGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172674
VALIDATED
PHF20 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 20
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000225875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-4836s21c1
Sequence:CCGGCATCACGGTTCTGGATAATTTCTCGAGAAATTATCCAGAACCGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-3500s21c1
Sequence:CCGGATCGTGCCACTGATGATAAACCTCGAGGTTTATCATCAGTGGCACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-2701s21c1
Sequence:CCGGCAGAAACCTCGCGCCTATTATCTCGAGATAATAGGCGCGAGGTTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-551s21c1
Sequence:GTACCGGGAGTAGTTCAAACTGTCAAACCTCGAGGTTTGACAGTTTGAACTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-2885s21c1
Sequence:GTACCGGCAAAGGTGAGAGAGTACATTTCTCGAGAAATGTACTCTCTCACCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-1590s21c1
Sequence:CCGGTAAATTGCTGCACTATCATATCTCGAGATATGATAGTGCAGCAATTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-610s21c1
Sequence:CCGGGTGGGTAATGCTAGGCCTAAACTCGAGTTTAGGCCTAGCATTACCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-240s21c1
Sequence:CCGGGGAAGCTCGGGACCGTTTAAACTCGAGTTTAAACGGTCCCGAGCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172674.2-1227s21c1
Sequence:CCGGTCTGGTTCATACGGTTGATACCTCGAGGTATCAACCGTATGAACCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-1499s21c1
Sequence:CCGGATGACTCTGTGACGTTGAATGCTCGAGCATTCAACGTCACAGAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172674
VALIDATED
PHF20 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 20
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000225875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-4836s21c1
Sequence:CCGGCATCACGGTTCTGGATAATTTCTCGAGAAATTATCCAGAACCGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-3500s21c1
Sequence:CCGGATCGTGCCACTGATGATAAACCTCGAGGTTTATCATCAGTGGCACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-2701s21c1
Sequence:CCGGCAGAAACCTCGCGCCTATTATCTCGAGATAATAGGCGCGAGGTTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-551s21c1
Sequence:GTACCGGGAGTAGTTCAAACTGTCAAACCTCGAGGTTTGACAGTTTGAACTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-2885s21c1
Sequence:GTACCGGCAAAGGTGAGAGAGTACATTTCTCGAGAAATGTACTCTCTCACCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-1590s21c1
Sequence:CCGGTAAATTGCTGCACTATCATATCTCGAGATATGATAGTGCAGCAATTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-610s21c1
Sequence:CCGGGTGGGTAATGCTAGGCCTAAACTCGAGTTTAGGCCTAGCATTACCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-240s21c1
Sequence:CCGGGGAAGCTCGGGACCGTTTAAACTCGAGTTTAAACGGTCCCGAGCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172674.2-1227s21c1
Sequence:CCGGTCTGGTTCATACGGTTGATACCTCGAGGTATCAACCGTATGAACCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-1499s21c1
Sequence:CCGGATGACTCTGTGACGTTGAATGCTCGAGCATTCAACGTCACAGAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172674
VALIDATED
PHF20 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 20
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000225875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-4836s21c1
Sequence:CCGGCATCACGGTTCTGGATAATTTCTCGAGAAATTATCCAGAACCGTGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-3500s21c1
Sequence:CCGGATCGTGCCACTGATGATAAACCTCGAGGTTTATCATCAGTGGCACGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-2701s21c1
Sequence:CCGGCAGAAACCTCGCGCCTATTATCTCGAGATAATAGGCGCGAGGTTTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-551s21c1
Sequence:GTACCGGGAGTAGTTCAAACTGTCAAACCTCGAGGTTTGACAGTTTGAACTACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-2885s21c1
Sequence:GTACCGGCAAAGGTGAGAGAGTACATTTCTCGAGAAATGTACTCTCTCACCTTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-1590s21c1
Sequence:CCGGTAAATTGCTGCACTATCATATCTCGAGATATGATAGTGCAGCAATTTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-610s21c1
Sequence:CCGGGTGGGTAATGCTAGGCCTAAACTCGAGTTTAGGCCTAGCATTACCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-240s21c1
Sequence:CCGGGGAAGCTCGGGACCGTTTAAACTCGAGTTTAAACGGTCCCGAGCTTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172674.2-1227s21c1
Sequence:CCGGTCTGGTTCATACGGTTGATACCTCGAGGTATCAACCGTATGAACCAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_172674.2-1499s21c1
Sequence:CCGGATGACTCTGTGACGTTGAATGCTCGAGCATTCAACGTCACAGAGTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)