EMAIL THIS PAGE TO A FRIEND

PHF20L1

PHD finger protein 20-like 1

469 Gene Product Result for
Synonyms: TDRD20B
Gene ID:
Mouse(239510) PHD finger protein 20-like 1
Rat(314964) PHD finger protein 20-like 1
Zebrafish(327626) PHD finger protein 20-like 1
dog(608229) PHD finger protein 20-like 1
domestic cat(101088302) PHD finger protein 20-like 1
Horse(100057982) PHD finger protein 20-like 1
chicken(420323) PHD finger protein 20-like 1
domestic guinea pig(100721789) PHD finger protein 20-like 1
naked mole-rat(101723763) PHD finger protein 20-like 1
cow(511990) PHD finger protein 20-like 1
sheep(101101898) PHD finger protein 20-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016018 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016018 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016018 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081409 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081409 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081409 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016018 Rosetta Predictions human pricing
NM_024878 Rosetta Predictions human pricing
NM_032205 Rosetta Predictions human pricing
NM_198513 Rosetta Predictions human pricing
XM_001065978 Rosetta Predictions rat pricing
XM_001067059 Rosetta Predictions rat pricing
XM_001067475 Rosetta Predictions rat pricing
NM_001081409 Rosetta Predictions mouse pricing
XM_484476 Rosetta Predictions mouse pricing
XM_897810 Rosetta Predictions mouse pricing
XM_897838 Rosetta Predictions mouse pricing
XM_897847 Rosetta Predictions mouse pricing
XM_897871 Rosetta Predictions mouse pricing
XM_980961 Rosetta Predictions mouse pricing
XM_981262 Rosetta Predictions mouse pricing
XM_981294 Rosetta Predictions mouse pricing
XM_981331 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243215 predicted 621
2 SASI_Hs01_00243216 predicted 657
3 SASI_Hs01_00243217 predicted 912
4 SASI_Hs01_00243218 predicted 623
5 SASI_Hs01_00243219 predicted 938
6 SASI_Hs02_00348700 predicted 912
7 SASI_Hs01_00243220 predicted 1674
8 SASI_Hs01_00243221 predicted 488
9 SASI_Hs01_00243223 predicted 1036
10 SASI_Hs01_00243224 predicted 1025
11 SASI_Hs01_00243222 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213193 predicted 935
2 SASI_Hs01_00213194 predicted 721
3 SASI_Hs01_00213195 predicted 1162
4 SASI_Hs01_00213196 predicted 666
5 SASI_Hs01_00213197 predicted 1051
6 SASI_Hs01_00213198 predicted 704
7 SASI_Hs01_00213199 predicted 455
8 SASI_Hs01_00213200 predicted 576
9 SASI_Hs01_00213201 predicted 867
10 SASI_Hs01_00213202 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359498 predicted 618
2 SASI_Hs02_00359499 predicted 660
3 SASI_Hs01_00223893 predicted 909
4 SASI_Hs02_00359500 predicted 618
5 SASI_Hs01_00223896 predicted 943
6 SASI_Hs01_00223897 predicted 912
7 SASI_Hs01_00223898 predicted 1666
8 SASI_Hs02_00359501 predicted 486
9 SASI_Hs01_00223902 predicted 1040
10 SASI_Hs02_00359502 predicted 1021
11 SASI_Hs01_00223894 predicted 795
12 SASI_Hs01_00223895 predicted 1642
13 SASI_Hs01_00223899 predicted 1017
14 SASI_Hs01_00223900 predicted 885
15 SASI_Hs01_00223901 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372083 predicted 614
2 SASI_Hs02_00372084 predicted 655
3 SASI_Hs02_00372085 predicted 823
4 SASI_Hs02_00372086 predicted 862
5 SASI_Hs02_00372087 predicted 490
6 SASI_Hs02_00372088 predicted 1213
7 SASI_Hs01_00132268 predicted 1167
8 SASI_Hs01_00132269 predicted 957
9 SASI_Hs02_00372089 predicted 942
10 SASI_Hs02_00372090 predicted 519
11 SASI_Hs01_00132264 predicted 1452
12 SASI_Hs01_00132265 predicted 1227
13 SASI_Hs01_00132266 predicted 1336
14 SASI_Hs01_00132267 predicted 1169
15 SASI_Hs01_00132270 predicted 1090
16 SASI_Hs01_00132271 predicted 1369
17 SASI_Hs01_00132272 predicted 1275
18 SASI_Hs01_00132273 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315955 predicted 1363
2 SASI_Rn02_00315956 predicted 902
3 SASI_Rn02_00315957 predicted 875
4 SASI_Rn02_00315958 predicted 905
5 SASI_Rn02_00315959 predicted 872
6 SASI_Rn02_00315960 predicted 866
7 SASI_Rn02_00315961 predicted 1352
8 SASI_Rn02_00315962 predicted 1346
9 SASI_Rn02_00315963 predicted 1354
10 SASI_Rn02_00315964 predicted 1358
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067059 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319750 predicted 987
2 SASI_Rn02_00319751 predicted 484
3 SASI_Rn02_00319752 predicted 441
4 SASI_Rn02_00319753 predicted 906
5 SASI_Rn02_00319754 predicted 629
6 SASI_Rn02_00319755 predicted 396
7 SASI_Rn02_00319756 predicted 519
8 SASI_Rn02_00319757 predicted 754
9 SASI_Rn02_00319758 predicted 838
10 SASI_Rn02_00319759 predicted 1505
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067475 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321117 predicted 2538
2 SASI_Rn02_00321118 predicted 2561
3 SASI_Rn02_00321119 predicted 481
4 SASI_Rn02_00321120 predicted 2539
5 SASI_Rn02_00321121 predicted 2297
6 SASI_Rn02_00321122 predicted 392
7 SASI_Rn02_00321123 predicted 2946
8 SASI_Rn02_00321124 predicted 513
9 SASI_Rn02_00321125 predicted 2750
10 SASI_Rn02_00321126 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298101 predicted 3447
2 SASI_Mm02_00298102 predicted 3369
3 SASI_Mm02_00298103 predicted 2293
4 SASI_Mm02_00298104 predicted 2527
5 SASI_Mm02_00298105 predicted 383
6 SASI_Mm02_00298106 predicted 2552
7 SASI_Mm02_00298107 predicted 430
8 SASI_Mm02_00298108 predicted 868
9 SASI_Mm02_00298109 predicted 3044
10 SASI_Mm02_00298110 predicted 2648
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245025 predicted 617
2 SASI_Mm01_00245026 predicted 392
3 SASI_Mm01_00245027 predicted 614
4 SASI_Mm01_00245028 predicted 442
5 SASI_Mm01_00245029 predicted 886
6 SASI_Mm01_00245030 predicted 685
7 SASI_Mm01_00245031 predicted 833
8 SASI_Mm01_00245032 predicted 487
9 SASI_Mm01_00245033 predicted 1510
10 SASI_Mm01_00245034 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285385 predicted 612
2 SASI_Mm01_00285386 predicted 1126
3 SASI_Mm01_00285387 predicted 390
4 SASI_Mm01_00285388 predicted 434
5 SASI_Mm01_00285389 predicted 795
6 SASI_Mm01_00285390 predicted 1087
7 SASI_Mm01_00285391 predicted 947
8 SASI_Mm01_00285392 predicted 676
9 SASI_Mm01_00285393 predicted 479
10 SASI_Mm01_00285394 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214746 predicted 2913
2 SASI_Mm01_00214747 predicted 2637
3 SASI_Mm01_00214748 predicted 2884
4 SASI_Mm01_00214749 predicted 2786
5 SASI_Mm01_00214750 predicted 2690
6 SASI_Mm01_00214751 predicted 2862
7 SASI_Mm01_00214752 predicted 2722
8 SASI_Mm01_00214753 predicted 2911
9 SASI_Mm01_00214754 predicted 2911
10 SASI_Mm01_00214755 predicted 2637
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897847 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245640 predicted 626
2 SASI_Mm01_00245641 predicted 1265
3 SASI_Mm01_00245642 predicted 1256
4 SASI_Mm01_00245643 predicted 408
5 SASI_Mm01_00245644 predicted 448
6 SASI_Mm01_00245645 predicted 893
7 SASI_Mm01_00245646 predicted 1355
8 SASI_Mm01_00245647 predicted 833
9 SASI_Mm01_00245648 predicted 1318
10 SASI_Mm01_00245649 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897871 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225765 predicted 621
2 SASI_Mm01_00225766 predicted 2213
3 SASI_Mm01_00225767 predicted 394
4 SASI_Mm01_00225768 predicted 431
5 SASI_Mm01_00225769 predicted 803
6 SASI_Mm01_00225770 predicted 943
7 SASI_Mm01_00225771 predicted 686
8 SASI_Mm01_00225772 predicted 2251
9 SASI_Mm01_00225773 predicted 481
10 SASI_Mm01_00225774 predicted 1418
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980961 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00240757 predicted 618
2 SASI_Mm01_00240758 predicted 1173
3 SASI_Mm01_00240759 predicted 1160
4 SASI_Mm01_00240760 predicted 387
5 SASI_Mm01_00240761 predicted 438
6 SASI_Mm01_00240762 predicted 803
7 SASI_Mm01_00240763 predicted 1270
8 SASI_Mm01_00240764 predicted 1230
9 SASI_Mm01_00240765 predicted 487
10 SASI_Mm01_00240766 predicted 955
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981262 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263590 predicted 4518
2 SASI_Mm01_00263591 predicted 4428
3 SASI_Mm01_00263592 predicted 3357
4 SASI_Mm01_00263593 predicted 3595
5 SASI_Mm01_00263594 predicted 3621
6 SASI_Mm01_00263595 predicted 4124
7 SASI_Mm01_00263596 predicted 4115
8 SASI_Mm01_00263597 predicted 3714
9 SASI_Mm01_00263598 predicted 3929
10 SASI_Mm01_00263599 predicted 3394
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981294 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282263 predicted 618
2 SASI_Mm01_00282264 predicted 3371
3 SASI_Mm01_00282265 predicted 2296
4 SASI_Mm01_00282266 predicted 2530
5 SASI_Mm01_00282267 predicted 2551
6 SASI_Mm01_00282268 predicted 439
7 SASI_Mm01_00282269 predicted 878
8 SASI_Mm01_00282270 predicted 824
9 SASI_Mm01_00282271 predicted 2325
10 SASI_Mm01_00282272 predicted 3429
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234364 predicted 612
2 SASI_Mm01_00234365 predicted 3291
3 SASI_Mm01_00234366 predicted 2217
4 SASI_Mm01_00234367 predicted 2455
5 SASI_Mm01_00234368 predicted 2476
6 SASI_Mm01_00234369 predicted 438
7 SASI_Mm01_00234370 predicted 800
8 SASI_Mm01_00234371 predicted 2257
9 SASI_Mm01_00234372 predicted 3354
10 SASI_Mm01_00234373 predicted 953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016018
VALIDATED
PHF20L1 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 20-like 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016018.4-467s21c1
Sequence:CCGGGAGCGCTGGAGTCATCGTTATCTCGAGATAACGATGACTCCAGCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016018.4-613s21c1
Sequence:CCGGTTGGACAGACTGTCGCTATTACTCGAGTAATAGCGACAGTCTGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016018.4-2570s21c1
Sequence:CCGGAGAATGTGCGGGTTATCATTTCTCGAGAAATGATAACCCGCACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016018.3-493s1c1
Sequence:CCGGGTGGATTTACTGGGATAGCAACTCGAGTTGCTATCCCAGTAAATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016018.4-3862s21c1
Sequence:CCGGTACGGAAATTTAGGGTATTTACTCGAGTAAATACCCTAAATTTCCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016018.3-1788s1c1
Sequence:CCGGCCTCAGATTCCTCTTACCGTACTCGAGTACGGTAAGAGGAATCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016018.3-1789s1c1
Sequence:CCGGCTCAGATTCCTCTTACCGTAACTCGAGTTACGGTAAGAGGAATCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016018.3-3090s1c1
Sequence:CCGGGCTCAGATGATGATGATGTTACTCGAGTAACATCATCATCATCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016018.3-2015s1c1
Sequence:CCGGCCAATAAGCTTATCAGGACTTCTCGAGAAGTCCTGATAAGCTTATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016018.3-635s1c1
Sequence:CCGGCCTGCCAAGATTGAAGCAATTCTCGAGAATTGCTTCAATCTTGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016018.3-1364s1c1
Sequence:CCGGGCTCGCAGCAAGAAATGCAAACTCGAGTTTGCATTTCTTGCTGCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016018.3-2337s1c1
Sequence:CCGGCCGTTGATCTTAGTGGTGAAACTCGAGTTTCACCACTAAGATCAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016018
VALIDATED
PHF20L1 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 20-like 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016018.4-467s21c1
Sequence:CCGGGAGCGCTGGAGTCATCGTTATCTCGAGATAACGATGACTCCAGCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016018.4-613s21c1
Sequence:CCGGTTGGACAGACTGTCGCTATTACTCGAGTAATAGCGACAGTCTGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016018.4-2570s21c1
Sequence:CCGGAGAATGTGCGGGTTATCATTTCTCGAGAAATGATAACCCGCACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016018.3-493s1c1
Sequence:CCGGGTGGATTTACTGGGATAGCAACTCGAGTTGCTATCCCAGTAAATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016018.4-3862s21c1
Sequence:CCGGTACGGAAATTTAGGGTATTTACTCGAGTAAATACCCTAAATTTCCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016018.3-1788s1c1
Sequence:CCGGCCTCAGATTCCTCTTACCGTACTCGAGTACGGTAAGAGGAATCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016018.3-1789s1c1
Sequence:CCGGCTCAGATTCCTCTTACCGTAACTCGAGTTACGGTAAGAGGAATCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016018.3-3090s1c1
Sequence:CCGGGCTCAGATGATGATGATGTTACTCGAGTAACATCATCATCATCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016018.3-2015s1c1
Sequence:CCGGCCAATAAGCTTATCAGGACTTCTCGAGAAGTCCTGATAAGCTTATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016018.3-635s1c1
Sequence:CCGGCCTGCCAAGATTGAAGCAATTCTCGAGAATTGCTTCAATCTTGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016018.3-1364s1c1
Sequence:CCGGGCTCGCAGCAAGAAATGCAAACTCGAGTTTGCATTTCTTGCTGCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016018.3-2337s1c1
Sequence:CCGGCCGTTGATCTTAGTGGTGAAACTCGAGTTTCACCACTAAGATCAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016018
VALIDATED
PHF20L1 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 20-like 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016018.4-467s21c1
Sequence:CCGGGAGCGCTGGAGTCATCGTTATCTCGAGATAACGATGACTCCAGCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016018.4-613s21c1
Sequence:CCGGTTGGACAGACTGTCGCTATTACTCGAGTAATAGCGACAGTCTGTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016018.4-2570s21c1
Sequence:CCGGAGAATGTGCGGGTTATCATTTCTCGAGAAATGATAACCCGCACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016018.3-493s1c1
Sequence:CCGGGTGGATTTACTGGGATAGCAACTCGAGTTGCTATCCCAGTAAATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016018.4-3862s21c1
Sequence:CCGGTACGGAAATTTAGGGTATTTACTCGAGTAAATACCCTAAATTTCCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016018.3-1788s1c1
Sequence:CCGGCCTCAGATTCCTCTTACCGTACTCGAGTACGGTAAGAGGAATCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016018.3-1789s1c1
Sequence:CCGGCTCAGATTCCTCTTACCGTAACTCGAGTTACGGTAAGAGGAATCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016018.3-3090s1c1
Sequence:CCGGGCTCAGATGATGATGATGTTACTCGAGTAACATCATCATCATCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016018.3-2015s1c1
Sequence:CCGGCCAATAAGCTTATCAGGACTTCTCGAGAAGTCCTGATAAGCTTATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016018.3-635s1c1
Sequence:CCGGCCTGCCAAGATTGAAGCAATTCTCGAGAATTGCTTCAATCTTGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016018.3-1364s1c1
Sequence:CCGGGCTCGCAGCAAGAAATGCAAACTCGAGTTTGCATTTCTTGCTGCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016018.3-2337s1c1
Sequence:CCGGCCGTTGATCTTAGTGGTGAAACTCGAGTTTCACCACTAAGATCAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081409
VALIDATED
PHF20L1 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 20-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081409.1-2044s21c1
Sequence:GTACCGGATCTAAACAGCACGATTATTCCTCGAGGAATAATCGTGCTGTTTAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081409.1-6020s21c1
Sequence:CCGGTAATTGGTTAAGGCCTATTATCTCGAGATAATAGGCCTTAACCAATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081409.1-1050s21c1
Sequence:CCGGCCGTTCCAAAGATCGTCTTTCCTCGAGGAAAGACGATCTTTGGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081409.1-601s21c1
Sequence:CCGGTTGGACAGACTGTCGCTATTACTCGAGTAATAGCGACAGTCTGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081409.1-455s21c1
Sequence:CCGGGAGCGCTGGAGTCATCGATATCTCGAGATATCGATGACTCCAGCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081409
VALIDATED
PHF20L1 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 20-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081409.1-2044s21c1
Sequence:GTACCGGATCTAAACAGCACGATTATTCCTCGAGGAATAATCGTGCTGTTTAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081409.1-6020s21c1
Sequence:CCGGTAATTGGTTAAGGCCTATTATCTCGAGATAATAGGCCTTAACCAATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081409.1-1050s21c1
Sequence:CCGGCCGTTCCAAAGATCGTCTTTCCTCGAGGAAAGACGATCTTTGGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081409.1-601s21c1
Sequence:CCGGTTGGACAGACTGTCGCTATTACTCGAGTAATAGCGACAGTCTGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081409.1-455s21c1
Sequence:CCGGGAGCGCTGGAGTCATCGATATCTCGAGATATCGATGACTCCAGCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081409
VALIDATED
PHF20L1 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 20-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081409.1-2044s21c1
Sequence:GTACCGGATCTAAACAGCACGATTATTCCTCGAGGAATAATCGTGCTGTTTAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081409.1-6020s21c1
Sequence:CCGGTAATTGGTTAAGGCCTATTATCTCGAGATAATAGGCCTTAACCAATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081409.1-1050s21c1
Sequence:CCGGCCGTTCCAAAGATCGTCTTTCCTCGAGGAAAGACGATCTTTGGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081409.1-601s21c1
Sequence:CCGGTTGGACAGACTGTCGCTATTACTCGAGTAATAGCGACAGTCTGTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081409.1-455s21c1
Sequence:CCGGGAGCGCTGGAGTCATCGATATCTCGAGATATCGATGACTCCAGCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)