EMAIL THIS PAGE TO A FRIEND

PHF21A

PHD finger protein 21A

230 Gene Product Result for
Synonyms: BHC80
Gene ID:
Human(51317) Summary: The PHF21A gene encodes BHC80, a component of a BRAF35 (MIM 605535)/histone deacetylase (HDAC; see MIM 601241) complex (BHC) that mediates repression of neuron-specific genes through the cis-regulatory element known as repressor element-1 (RE1) or neural restrictive silencer (NRS) (Hakimi et al., 2002 [PubMed 12032298]
Mouse(192285) PHD finger protein 21A
Rat(362166) PHD finger protein 21A
cow(510395) PHD finger protein 21A
sheep(101113270) PHD finger protein 21A
naked mole-rat(101702080) PHD finger protein 21A
domestic guinea pig(100731266) PHD finger protein 21A
chicken(423199) PHD finger protein 21A
dog(483637) PHD finger protein 21A
Horse(100050418) PHD finger protein 21A
domestic cat(101086503) PHD finger protein 21A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138755 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138755 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138755 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016621 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101802 Rosetta Predictions human pricing
NM_016621 Rosetta Predictions human pricing
XM_001070000 Rosetta Predictions rat pricing
XM_342467 Rosetta Predictions rat pricing
NM_001109690 Rosetta Predictions mouse pricing
NM_001109691 Rosetta Predictions mouse pricing
NM_138755 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322973 predicted 2824
2 SASI_Hs02_00322974 predicted 2331
3 SASI_Hs02_00322975 predicted 2842
4 SASI_Hs02_00322976 predicted 1617
5 SASI_Hs02_00322977 predicted 2504
6 SASI_Hs02_00322978 predicted 1615
7 SASI_Hs02_00322979 predicted 2861
8 SASI_Hs02_00322980 predicted 2926
9 SASI_Hs02_00322981 predicted 2819
10 SASI_Hs02_00322982 predicted 2936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349774 predicted 2685
2 SASI_Hs01_00208597 predicted 2193
3 SASI_Hs02_00349775 predicted 2707
4 SASI_Hs02_00349776 predicted 1613
5 SASI_Hs01_00208601 predicted 2374
6 SASI_Hs02_00349777 predicted 1618
7 SASI_Hs02_00349778 predicted 2715
8 SASI_Hs02_00349779 predicted 2785
9 SASI_Hs02_00349780 predicted 2690
10 SASI_Hs02_00349781 predicted 2805
11 SASI_Hs01_00208594 predicted 1896
12 SASI_Hs01_00208595 predicted 1743
13 SASI_Hs01_00208596 predicted 1594
14 SASI_Hs01_00208598 predicted 1945
15 SASI_Hs01_00208599 predicted 1517
16 SASI_Hs01_00208600 predicted 1883
17 SASI_Hs01_00208602 predicted 1500
18 SASI_Hs01_00208603 predicted 1336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330053 predicted 1732
2 SASI_Rn02_00330054 predicted 2158
3 SASI_Rn02_00330055 predicted 1698
4 SASI_Rn02_00330056 predicted 1669
5 SASI_Rn02_00330057 predicted 1563
6 SASI_Rn02_00330058 predicted 1241
7 SASI_Rn02_00330059 predicted 1546
8 SASI_Rn02_00330060 predicted 1906
9 SASI_Rn02_00330061 predicted 2350
10 SASI_Rn02_00330062 predicted 2163
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394309 predicted 1501
2 SASI_Rn02_00394310 predicted 1919
3 SASI_Rn02_00394311 predicted 1464
4 SASI_Rn02_00394312 predicted 1429
5 SASI_Rn02_00394313 predicted 1323
6 SASI_Rn02_00394314 predicted 1009
7 SASI_Rn02_00394315 predicted 1315
8 SASI_Rn02_00394316 predicted 1669
9 SASI_Rn02_00394317 predicted 2112
10 SASI_Rn02_00394318 predicted 1923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304174 predicted 890
2 SASI_Mm02_00304175 predicted 1727
3 SASI_Mm02_00304176 predicted 2254
4 SASI_Mm02_00304177 predicted 2233
5 SASI_Mm02_00304178 predicted 1724
6 SASI_Mm02_00304179 predicted 1732
7 SASI_Mm02_00304180 predicted 891
8 SASI_Mm02_00304181 predicted 2300
9 SASI_Mm02_00304182 predicted 1792
10 SASI_Mm02_00304183 predicted 2245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304184 predicted 1041
2 SASI_Mm02_00304185 predicted 1877
3 SASI_Mm02_00304186 predicted 2404
4 SASI_Mm02_00304187 predicted 2392
5 SASI_Mm02_00304188 predicted 1881
6 SASI_Mm02_00304189 predicted 1883
7 SASI_Mm02_00304190 predicted 1049
8 SASI_Mm02_00304191 predicted 2456
9 SASI_Mm02_00304192 predicted 1949
10 SASI_Mm02_00304193 predicted 2405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339807 predicted 1052
2 SASI_Mm01_00140671 predicted 1746
3 SASI_Mm02_00339808 predicted 2266
4 SASI_Mm02_00339809 predicted 2255
5 SASI_Mm02_00339810 predicted 1739
6 SASI_Mm02_00339811 predicted 1748
7 SASI_Mm02_00339812 predicted 1050
8 SASI_Mm02_00339813 predicted 2324
9 SASI_Mm02_00339814 predicted 1811
10 SASI_Mm02_00339815 predicted 2265
11 SASI_Mm01_00140667 predicted 1279
12 SASI_Mm01_00140668 predicted 1528
13 SASI_Mm01_00140669 predicted 999
14 SASI_Mm01_00140670 predicted 276
15 SASI_Mm01_00140672 predicted 1169
16 SASI_Mm01_00140673 predicted 1250
17 SASI_Mm01_00140674 predicted 1591
18 SASI_Mm01_00140675 predicted 1545
19 SASI_Mm01_00140676 predicted 1430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138755
VALIDATED
PHF21A MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 21A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138755.1-2002s1c1
Sequence:CCGGCCGGATTTCTTCTGGAAAGTACTCGAGTACTTTCCAGAAGAAATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138755.1-1557s1c1
Sequence:CCGGCATTCCTACATCGCCTACAAACTCGAGTTTGTAGGCGATGTAGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138755.1-1021s1c1
Sequence:CCGGGCCTGGAGAAACAGACAGTTACTCGAGTAACTGTCTGTTTCTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138755.1-443s1c1
Sequence:CCGGGCGCAAGAACCTGATAGTCAACTCGAGTTGACTATCAGGTTCTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138755.1-674s1c1
Sequence:CCGGGCCCATCAAAGTACCACAGTTCTCGAGAACTGTGGTACTTTGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138755.2-1703s21c1
Sequence:CCGGATTCCTACATCGCCTACAAAGCTCGAGCTTTGTAGGCGATGTAGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138755.2-1755s21c1
Sequence:CCGGTAAGTGGAGTTCAGATTTAAACTCGAGTTTAAATCTGAACTCCACTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138755.2-1419s21c1
Sequence:CCGGGAGTGCAGTCACTTACCTTAACTCGAGTTAAGGTAAGTGACTGCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138755.2-2226s21c1
Sequence:CCGGCCCGAGTTTGCCAATTGATTCCTCGAGGAATCAATTGGCAAACTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138755.2-1809s21c1
Sequence:CCGGAGAGCTCAGCAGTTCTATAAGCTCGAGCTTATAGAACTGCTGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138755
VALIDATED
PHF21A MISSION shRNA shRNA Plasmid DNA
PHD finger protein 21A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138755.1-2002s1c1
Sequence:CCGGCCGGATTTCTTCTGGAAAGTACTCGAGTACTTTCCAGAAGAAATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138755.1-1557s1c1
Sequence:CCGGCATTCCTACATCGCCTACAAACTCGAGTTTGTAGGCGATGTAGGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138755.1-1021s1c1
Sequence:CCGGGCCTGGAGAAACAGACAGTTACTCGAGTAACTGTCTGTTTCTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138755.1-443s1c1
Sequence:CCGGGCGCAAGAACCTGATAGTCAACTCGAGTTGACTATCAGGTTCTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138755.1-674s1c1
Sequence:CCGGGCCCATCAAAGTACCACAGTTCTCGAGAACTGTGGTACTTTGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138755.2-1703s21c1
Sequence:CCGGATTCCTACATCGCCTACAAAGCTCGAGCTTTGTAGGCGATGTAGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138755.2-1755s21c1
Sequence:CCGGTAAGTGGAGTTCAGATTTAAACTCGAGTTTAAATCTGAACTCCACTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138755.2-1419s21c1
Sequence:CCGGGAGTGCAGTCACTTACCTTAACTCGAGTTAAGGTAAGTGACTGCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138755.2-2226s21c1
Sequence:CCGGCCCGAGTTTGCCAATTGATTCCTCGAGGAATCAATTGGCAAACTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138755.2-1809s21c1
Sequence:CCGGAGAGCTCAGCAGTTCTATAAGCTCGAGCTTATAGAACTGCTGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138755
VALIDATED
PHF21A MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 21A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138755.1-2002s1c1
Sequence:CCGGCCGGATTTCTTCTGGAAAGTACTCGAGTACTTTCCAGAAGAAATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138755.1-1557s1c1
Sequence:CCGGCATTCCTACATCGCCTACAAACTCGAGTTTGTAGGCGATGTAGGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138755.1-1021s1c1
Sequence:CCGGGCCTGGAGAAACAGACAGTTACTCGAGTAACTGTCTGTTTCTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138755.1-443s1c1
Sequence:CCGGGCGCAAGAACCTGATAGTCAACTCGAGTTGACTATCAGGTTCTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138755.1-674s1c1
Sequence:CCGGGCCCATCAAAGTACCACAGTTCTCGAGAACTGTGGTACTTTGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138755.2-1703s21c1
Sequence:CCGGATTCCTACATCGCCTACAAAGCTCGAGCTTTGTAGGCGATGTAGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138755.2-1755s21c1
Sequence:CCGGTAAGTGGAGTTCAGATTTAAACTCGAGTTTAAATCTGAACTCCACTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138755.2-1419s21c1
Sequence:CCGGGAGTGCAGTCACTTACCTTAACTCGAGTTAAGGTAAGTGACTGCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138755.2-2226s21c1
Sequence:CCGGCCCGAGTTTGCCAATTGATTCCTCGAGGAATCAATTGGCAAACTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138755.2-1809s21c1
Sequence:CCGGAGAGCTCAGCAGTTCTATAAGCTCGAGCTTATAGAACTGCTGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016621
VALIDATED
PHF21A MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 21A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016621.2-2014s1c1
Sequence:CCGGGCTCAGCAATTCCATAAGTAACTCGAGTTACTTATGGAATTGCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016621.3-1077s21c1
Sequence:CCGGCCAGAGACCTACCATTGCTATCTCGAGATAGCAATGGTAGGTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016621.2-1106s1c1
Sequence:CCGGGCCCAGAATAACATTCCTATTCTCGAGAATAGGAATGTTATTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016621.2-1883s1c1
Sequence:CCGGCCTGGAACTTTAGCAATTGTTCTCGAGAACAATTGCTAAAGTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016621.2-1022s1c1
Sequence:CCGGCCCATCAAAGTACCACAGTTTCTCGAGAAACTGTGGTACTTTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016621.2-838s1c1
Sequence:CCGGCCAGAGACCTACCATTGCTATCTCGAGATAGCAATGGTAGGTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016621.3-2991s21c1
Sequence:CCGGCTAAACTTTCGCTACTATAAACTCGAGTTTATAGTAGCGAAAGTTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016621.3-798s21c1
Sequence:CCGGACGGAAGAACCTGATAGTAAACTCGAGTTTACTATCAGGTTCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016621.3-1345s21c1
Sequence:CCGGGCCCAGAATAACATTCCTATTCTCGAGAATAGGAATGTTATTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016621.3-1261s21c1
Sequence:CCGGCCCATCAAAGTACCACAGTTTCTCGAGAAACTGTGGTACTTTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016621
VALIDATED
PHF21A MISSION shRNA shRNA Plasmid DNA
PHD finger protein 21A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016621.2-2014s1c1
Sequence:CCGGGCTCAGCAATTCCATAAGTAACTCGAGTTACTTATGGAATTGCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016621.3-1077s21c1
Sequence:CCGGCCAGAGACCTACCATTGCTATCTCGAGATAGCAATGGTAGGTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016621.2-1106s1c1
Sequence:CCGGGCCCAGAATAACATTCCTATTCTCGAGAATAGGAATGTTATTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016621.2-1883s1c1
Sequence:CCGGCCTGGAACTTTAGCAATTGTTCTCGAGAACAATTGCTAAAGTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016621.2-1022s1c1
Sequence:CCGGCCCATCAAAGTACCACAGTTTCTCGAGAAACTGTGGTACTTTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016621.2-838s1c1
Sequence:CCGGCCAGAGACCTACCATTGCTATCTCGAGATAGCAATGGTAGGTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016621.3-2991s21c1
Sequence:CCGGCTAAACTTTCGCTACTATAAACTCGAGTTTATAGTAGCGAAAGTTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016621.3-798s21c1
Sequence:CCGGACGGAAGAACCTGATAGTAAACTCGAGTTTACTATCAGGTTCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016621.3-1345s21c1
Sequence:CCGGGCCCAGAATAACATTCCTATTCTCGAGAATAGGAATGTTATTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016621.3-1261s21c1
Sequence:CCGGCCCATCAAAGTACCACAGTTTCTCGAGAAACTGTGGTACTTTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016621
VALIDATED
PHF21A MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 21A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016621.2-2014s1c1
Sequence:CCGGGCTCAGCAATTCCATAAGTAACTCGAGTTACTTATGGAATTGCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016621.3-1077s21c1
Sequence:CCGGCCAGAGACCTACCATTGCTATCTCGAGATAGCAATGGTAGGTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016621.2-1106s1c1
Sequence:CCGGGCCCAGAATAACATTCCTATTCTCGAGAATAGGAATGTTATTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016621.2-1883s1c1
Sequence:CCGGCCTGGAACTTTAGCAATTGTTCTCGAGAACAATTGCTAAAGTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016621.2-1022s1c1
Sequence:CCGGCCCATCAAAGTACCACAGTTTCTCGAGAAACTGTGGTACTTTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016621.2-838s1c1
Sequence:CCGGCCAGAGACCTACCATTGCTATCTCGAGATAGCAATGGTAGGTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312641    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016621.3-2991s21c1
Sequence:CCGGCTAAACTTTCGCTACTATAAACTCGAGTTTATAGTAGCGAAAGTTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016621.3-798s21c1
Sequence:CCGGACGGAAGAACCTGATAGTAAACTCGAGTTTACTATCAGGTTCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016621.3-1345s21c1
Sequence:CCGGGCCCAGAATAACATTCCTATTCTCGAGAATAGGAATGTTATTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016621.3-1261s21c1
Sequence:CCGGCCCATCAAAGTACCACAGTTTCTCGAGAAACTGTGGTACTTTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)