EMAIL THIS PAGE TO A FRIEND

PHF21B

PHD finger protein 21B

98 Gene Product Result for
Synonyms: BHC80L PHF4
Gene ID:
Mouse(271305) PHD finger protein 21B
Rat(300117) PHD finger protein 21B
chicken(427935) PHD finger protein 21B
domestic cat(101094360) PHD finger protein 21B
Horse(100051423) PHD finger protein 21B
dog(609150) PHD finger protein 21B
domestic guinea pig(100722763) PHD finger protein 21B
naked mole-rat(101703002) PHD finger protein 21B
cow(618757) PHD finger protein 21B
sheep(101108478) PHD finger protein 21B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138415 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081166 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081166 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081166 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138415 Rosetta Predictions human pricing
NM_001130680 Rosetta Predictions rat pricing
NM_001081166 Rosetta Predictions mouse pricing
XM_001003012 Rosetta Predictions mouse pricing
XM_194983 Rosetta Predictions mouse pricing
XM_901944 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117118 predicted 1833
2 SASI_Hs01_00117119 predicted 1334
3 SASI_Hs01_00117120 predicted 2130
4 SASI_Hs01_00117121 predicted 2224
5 SASI_Hs01_00117122 predicted 2184
6 SASI_Hs01_00117123 predicted 362
7 SASI_Hs01_00117124 predicted 1810
8 SASI_Hs01_00117126 predicted 1772
9 SASI_Hs01_00117127 predicted 491
10 SASI_Hs02_00363555 predicted 2168
11 SASI_Hs01_00117125 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256019 predicted 1307
2 SASI_Rn02_00256020 predicted 1584
3 SASI_Rn02_00256021 predicted 518
4 SASI_Rn02_00256022 predicted 1201
5 SASI_Rn02_00256023 predicted 620
6 SASI_Rn02_00256024 predicted 1053
7 SASI_Rn02_00256025 predicted 1529
8 SASI_Rn02_00256026 predicted 1531
9 SASI_Rn02_00256027 predicted 996
10 SASI_Rn02_00256028 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295831 predicted 1958
2 SASI_Mm02_00295832 predicted 1388
3 SASI_Mm02_00295833 predicted 2015
4 SASI_Mm02_00295834 predicted 448
5 SASI_Mm02_00295835 predicted 1281
6 SASI_Mm02_00295836 predicted 551
7 SASI_Mm02_00295837 predicted 1960
8 SASI_Mm02_00295838 predicted 2016
9 SASI_Mm02_00295839 predicted 1973
10 SASI_Mm02_00295840 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223412 predicted 2238
2 SASI_Mm01_00223413 predicted 1870
3 SASI_Mm01_00223414 predicted 447
4 SASI_Mm01_00223415 predicted 1129
5 SASI_Mm01_00223416 predicted 2186
6 SASI_Mm01_00223417 predicted 557
7 SASI_Mm01_00223418 predicted 1862
8 SASI_Mm01_00223419 predicted 2104
9 SASI_Mm01_00223420 predicted 1822
10 SASI_Mm01_00223421 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_194983 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273761 predicted 1962
2 SASI_Mm01_00273762 predicted 1386
3 SASI_Mm01_00273763 predicted 2016
4 SASI_Mm01_00273764 predicted 448
5 SASI_Mm01_00273765 predicted 1279
6 SASI_Mm01_00273766 predicted 550
7 SASI_Mm01_00273767 predicted 1960
8 SASI_Mm01_00273768 predicted 2016
9 SASI_Mm01_00273769 predicted 1975
10 SASI_Mm01_00273770 predicted 2092
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274846 predicted 914
2 SASI_Mm01_00274847 predicted 483
3 SASI_Mm01_00274848 predicted 541
4 SASI_Mm01_00274849 predicted 855
5 SASI_Mm01_00274850 predicted 609
6 SASI_Mm01_00274851 predicted 839
7 SASI_Mm01_00274852 predicted 479
8 SASI_Mm01_00274853 predicted 361
9 SASI_Mm01_00274854 predicted 850
10 SASI_Mm01_00274855 predicted 786
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138415
VALIDATED
PHF21B MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 21B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138415.3-1814s21c1
Sequence:CCGGCTGTCGGCCTTAATTCATAAACTCGAGTTTATGAATTAAGGCCGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138415.3-1388s21c1
Sequence:CCGGCTGGCCATCGTGCACTCTTATCTCGAGATAAGAGTGCACGATGGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138415.3-1336s21c1
Sequence:CCGGGTGCCAGCAGAAGGCCTTAAACTCGAGTTTAAGGCCTTCTGCTGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138415.3-1764s21c1
Sequence:CCGGTTCATACCCACGGAAAGTTATCTCGAGATAACTTTCCGTGGGTATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138415.1-842s1c1
Sequence:CCGGGTCATCATCATTCAGCCTCAACTCGAGTTGAGGCTGAATGATGATGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138415.1-1009s1c1
Sequence:CCGGCCTGGTTACCACGGAACATTTCTCGAGAAATGTTCCGTGGTAACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138415.1-365s1c1
Sequence:CCGGGTTAGGCCAAAGACTCTGATTCTCGAGAATCAGAGTCTTTGGCCTAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138415.1-1522s1c1
Sequence:CCGGAGTGCAGAAATGCCTGGAGTTCTCGAGAACTCCAGGCATTTCTGCACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138415.1-1399s1c1
Sequence:CCGGGCACTCTTATGTCACCCACAACTCGAGTTGTGGGTGACATAAGAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138415
VALIDATED
PHF21B MISSION shRNA shRNA Plasmid DNA
PHD finger protein 21B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138415.3-1814s21c1
Sequence:CCGGCTGTCGGCCTTAATTCATAAACTCGAGTTTATGAATTAAGGCCGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138415.3-1388s21c1
Sequence:CCGGCTGGCCATCGTGCACTCTTATCTCGAGATAAGAGTGCACGATGGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138415.3-1336s21c1
Sequence:CCGGGTGCCAGCAGAAGGCCTTAAACTCGAGTTTAAGGCCTTCTGCTGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138415.3-1764s21c1
Sequence:CCGGTTCATACCCACGGAAAGTTATCTCGAGATAACTTTCCGTGGGTATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138415.1-842s1c1
Sequence:CCGGGTCATCATCATTCAGCCTCAACTCGAGTTGAGGCTGAATGATGATGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138415.1-1009s1c1
Sequence:CCGGCCTGGTTACCACGGAACATTTCTCGAGAAATGTTCCGTGGTAACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138415.1-365s1c1
Sequence:CCGGGTTAGGCCAAAGACTCTGATTCTCGAGAATCAGAGTCTTTGGCCTAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138415.1-1522s1c1
Sequence:CCGGAGTGCAGAAATGCCTGGAGTTCTCGAGAACTCCAGGCATTTCTGCACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138415.1-1399s1c1
Sequence:CCGGGCACTCTTATGTCACCCACAACTCGAGTTGTGGGTGACATAAGAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138415
VALIDATED
PHF21B MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 21B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138415.3-1814s21c1
Sequence:CCGGCTGTCGGCCTTAATTCATAAACTCGAGTTTATGAATTAAGGCCGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138415.3-1388s21c1
Sequence:CCGGCTGGCCATCGTGCACTCTTATCTCGAGATAAGAGTGCACGATGGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138415.3-1336s21c1
Sequence:CCGGGTGCCAGCAGAAGGCCTTAAACTCGAGTTTAAGGCCTTCTGCTGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138415.3-1764s21c1
Sequence:CCGGTTCATACCCACGGAAAGTTATCTCGAGATAACTTTCCGTGGGTATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138415.1-842s1c1
Sequence:CCGGGTCATCATCATTCAGCCTCAACTCGAGTTGAGGCTGAATGATGATGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138415.1-1009s1c1
Sequence:CCGGCCTGGTTACCACGGAACATTTCTCGAGAAATGTTCCGTGGTAACCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138415.1-365s1c1
Sequence:CCGGGTTAGGCCAAAGACTCTGATTCTCGAGAATCAGAGTCTTTGGCCTAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138415.1-1522s1c1
Sequence:CCGGAGTGCAGAAATGCCTGGAGTTCTCGAGAACTCCAGGCATTTCTGCACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138415.1-1399s1c1
Sequence:CCGGGCACTCTTATGTCACCCACAACTCGAGTTGTGGGTGACATAAGAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081166
PHF21B MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 21B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081166.1-1041s21c1
Sequence:CCGGTCTTCCAGGTTATCATCATTCCTCGAGGAATGATGATAACCTGGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081166.1-1608s21c1
Sequence:CCGGTCACCCACAAGACAGTGAAAGCTCGAGCTTTCACTGTCTTGTGGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081166.1-970s21c1
Sequence:CCGGCCCTTTCAGGACCTACCTAACCTCGAGGTTAGGTAGGTCCTGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081166.1-1826s21c1
Sequence:CCGGCAGATGCTTCAGGTCGCTATGCTCGAGCATAGCGACCTGAAGCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081166.1-3480s21c1
Sequence:CCGGTGGTTACGCGGTGCCGATTATCTCGAGATAATCGGCACCGCGTAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081166
PHF21B MISSION shRNA shRNA Plasmid DNA
PHD finger protein 21B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081166.1-1041s21c1
Sequence:CCGGTCTTCCAGGTTATCATCATTCCTCGAGGAATGATGATAACCTGGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081166.1-1608s21c1
Sequence:CCGGTCACCCACAAGACAGTGAAAGCTCGAGCTTTCACTGTCTTGTGGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081166.1-970s21c1
Sequence:CCGGCCCTTTCAGGACCTACCTAACCTCGAGGTTAGGTAGGTCCTGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081166.1-1826s21c1
Sequence:CCGGCAGATGCTTCAGGTCGCTATGCTCGAGCATAGCGACCTGAAGCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081166.1-3480s21c1
Sequence:CCGGTGGTTACGCGGTGCCGATTATCTCGAGATAATCGGCACCGCGTAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081166
PHF21B MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 21B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081166.1-1041s21c1
Sequence:CCGGTCTTCCAGGTTATCATCATTCCTCGAGGAATGATGATAACCTGGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081166.1-1608s21c1
Sequence:CCGGTCACCCACAAGACAGTGAAAGCTCGAGCTTTCACTGTCTTGTGGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081166.1-970s21c1
Sequence:CCGGCCCTTTCAGGACCTACCTAACCTCGAGGTTAGGTAGGTCCTGAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081166.1-1826s21c1
Sequence:CCGGCAGATGCTTCAGGTCGCTATGCTCGAGCATAGCGACCTGAAGCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081166.1-3480s21c1
Sequence:CCGGTGGTTACGCGGTGCCGATTATCTCGAGATAATCGGCACCGCGTAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)