EMAIL THIS PAGE TO A FRIEND

PHF23

PHD finger protein 23

84 Gene Product Result for
Synonyms: hJUNE-1b
UniProtKB ID: Q9BUL5, A1DZ74, D3DTN4, Q8IZK0, Q96HG7, Q9H5X0
Gene ID:
Mouse(78246) PHD finger protein 23
Rat(360550) PHD finger protein 23
cow(539774) PHD finger protein 23
sheep(101118033) PHD finger protein 23
naked mole-rat(101711225) PHD finger protein 23
domestic guinea pig(100713629) PHD finger protein 23
domestic cat(101095529) PHD finger protein 23
dog(489465) PHD finger protein 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024297 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024297 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024297 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030064 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030064 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030064 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086321 MISSION® esiRNA esiRNA human PHF23 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024297 Rosetta Predictions human pricing
NM_001004272 Rosetta Predictions rat pricing
NM_030064 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029949 predicted 622
2 SASI_Hs01_00029951 predicted 1431
3 SASI_Hs02_00356638 predicted 1607
4 SASI_Hs02_00356639 predicted 1708
5 SASI_Hs01_00029953 predicted 1519
6 SASI_Hs01_00029955 predicted 1220
7 SASI_Hs01_00029956 predicted 1310
8 SASI_Hs02_00356640 predicted 1541
9 SASI_Hs02_00356641 predicted 1273
10 SASI_Hs01_00029957 predicted 507
11 SASI_Hs01_00029950 predicted 1184
12 SASI_Hs01_00029952 predicted 564
13 SASI_Hs01_00029954 predicted 1331
14 SASI_Hs01_00029958 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004272 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063939 predicted 1278
2 SASI_Rn01_00063940 predicted 951
3 SASI_Rn01_00063942 predicted 944
4 SASI_Rn01_00063943 predicted 234
5 SASI_Rn01_00063944 predicted 1050
6 SASI_Rn01_00063946 predicted 240
7 SASI_Rn01_00063947 predicted 1363
8 SASI_Rn01_00063948 predicted 229
9 SASI_Rn02_00198304 predicted 1151
10 SASI_Rn02_00198305 predicted 1443
11 SASI_Rn01_00063941 predicted 1155
12 SASI_Rn01_00063945 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030064 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097552 predicted 1648
2 SASI_Mm01_00097553 predicted 532
3 SASI_Mm01_00097554 predicted 1467
4 SASI_Mm01_00097555 predicted 1556
5 SASI_Mm01_00097556 predicted 1322
6 SASI_Mm01_00097557 predicted 293
7 SASI_Mm01_00097558 predicted 1350
8 SASI_Mm02_00336443 predicted 1236
9 SASI_Mm01_00097560 predicted 385
10 SASI_Mm01_00097561 predicted 295
11 SASI_Mm01_00097559 predicted 328
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024297
VALIDATED
PHF23 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 23
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_024297.1-552s1c1
Sequence:CCGGGCTTGAGAAGATGAAGCTCAACTCGAGTTGAGCTTCATCTTCTCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024297.2-1624s21c1
Sequence:GTACCGGACTTGAAATTGAATCCATTACCTCGAGGTAATGGATTCAATTTCAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_024297.1-252s1c1
Sequence:CCGGGCGGAGAACAATTGAGGATTTCTCGAGAAATCCTCAATTGTTCTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024297.1-711s1c1
Sequence:CCGGGAAGGACCGAAAGAACCGAAACTCGAGTTTCGGTTCTTTCGGTCCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_024297.1-822s1c1
Sequence:CCGGGAGCAAGAAGCGGAAGTTAAACTCGAGTTTAACTTCCGCTTCTTGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024297.1-420s1c1
Sequence:CCGGTCTTCGAACCATCCAGACTTTCTCGAGAAAGTCTGGATGGTTCGAAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024297.2-1826s21c1
Sequence:CCGGTTCTTCTACACCGGTTGTATTCTCGAGAATACAACCGGTGTAGAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024297.2-1318s21c1
Sequence:CCGGACCTCTCCTGTGCTAAGATTACTCGAGTAATCTTAGCACAGGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_024297.2-1433s21c1
Sequence:CCGGGCCCTGATGGCACCAACTTTACTCGAGTAAAGTTGGTGCCATCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_024297.2-1236s21c1
Sequence:CCGGTGGGATCTGATCACATGTTACCTCGAGGTAACATGTGATCAGATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024297.2-608s21c1
Sequence:CCGGGCTTGAGAAGATGAAGCTCAACTCGAGTTGAGCTTCATCTTCTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024297
VALIDATED
PHF23 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 23
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_024297.1-552s1c1
Sequence:CCGGGCTTGAGAAGATGAAGCTCAACTCGAGTTGAGCTTCATCTTCTCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024297.2-1624s21c1
Sequence:GTACCGGACTTGAAATTGAATCCATTACCTCGAGGTAATGGATTCAATTTCAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_024297.1-252s1c1
Sequence:CCGGGCGGAGAACAATTGAGGATTTCTCGAGAAATCCTCAATTGTTCTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024297.1-711s1c1
Sequence:CCGGGAAGGACCGAAAGAACCGAAACTCGAGTTTCGGTTCTTTCGGTCCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_024297.1-822s1c1
Sequence:CCGGGAGCAAGAAGCGGAAGTTAAACTCGAGTTTAACTTCCGCTTCTTGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024297.1-420s1c1
Sequence:CCGGTCTTCGAACCATCCAGACTTTCTCGAGAAAGTCTGGATGGTTCGAAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024297.2-1826s21c1
Sequence:CCGGTTCTTCTACACCGGTTGTATTCTCGAGAATACAACCGGTGTAGAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024297.2-1318s21c1
Sequence:CCGGACCTCTCCTGTGCTAAGATTACTCGAGTAATCTTAGCACAGGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_024297.2-1433s21c1
Sequence:CCGGGCCCTGATGGCACCAACTTTACTCGAGTAAAGTTGGTGCCATCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_024297.2-1236s21c1
Sequence:CCGGTGGGATCTGATCACATGTTACCTCGAGGTAACATGTGATCAGATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024297.2-608s21c1
Sequence:CCGGGCTTGAGAAGATGAAGCTCAACTCGAGTTGAGCTTCATCTTCTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024297
VALIDATED
PHF23 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 23
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_024297.1-552s1c1
Sequence:CCGGGCTTGAGAAGATGAAGCTCAACTCGAGTTGAGCTTCATCTTCTCAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024297.2-1624s21c1
Sequence:GTACCGGACTTGAAATTGAATCCATTACCTCGAGGTAATGGATTCAATTTCAAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_024297.1-252s1c1
Sequence:CCGGGCGGAGAACAATTGAGGATTTCTCGAGAAATCCTCAATTGTTCTCCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024297.1-711s1c1
Sequence:CCGGGAAGGACCGAAAGAACCGAAACTCGAGTTTCGGTTCTTTCGGTCCTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_024297.1-822s1c1
Sequence:CCGGGAGCAAGAAGCGGAAGTTAAACTCGAGTTTAACTTCCGCTTCTTGCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024297.1-420s1c1
Sequence:CCGGTCTTCGAACCATCCAGACTTTCTCGAGAAAGTCTGGATGGTTCGAAGATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024297.2-1826s21c1
Sequence:CCGGTTCTTCTACACCGGTTGTATTCTCGAGAATACAACCGGTGTAGAAGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024297.2-1318s21c1
Sequence:CCGGACCTCTCCTGTGCTAAGATTACTCGAGTAATCTTAGCACAGGAGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_024297.2-1433s21c1
Sequence:CCGGGCCCTGATGGCACCAACTTTACTCGAGTAAAGTTGGTGCCATCAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_024297.2-1236s21c1
Sequence:CCGGTGGGATCTGATCACATGTTACCTCGAGGTAACATGTGATCAGATCCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024297.2-608s21c1
Sequence:CCGGGCTTGAGAAGATGAAGCTCAACTCGAGTTGAGCTTCATCTTCTCAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030064
VALIDATED
PHF23 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 23
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030064.2-274s21c1
Sequence:CCGGGATCCGCCTCCGACTCTTAAACTCGAGTTTAAGAGTCGGAGGCGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030064.2-682s21c1
Sequence:CCGGCCACTCTCTCCCACATCATTGCTCGAGCAATGATGTGGGAGAGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030064.2-321s21c1
Sequence:CCGGGCGGAGAACCATTGAGGATTTCTCGAGAAATCCTCAATGGTTCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030064.2-1547s21c1
Sequence:CCGGATTCCCAAGGGAGACGTATTTCTCGAGAAATACGTCTCCCTTGGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030064.2-1243s21c1
Sequence:CCGGTGGGATCTGATCACGTGTTACCTCGAGGTAACACGTGATCAGATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030064
VALIDATED
PHF23 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 23
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030064.2-274s21c1
Sequence:CCGGGATCCGCCTCCGACTCTTAAACTCGAGTTTAAGAGTCGGAGGCGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030064.2-682s21c1
Sequence:CCGGCCACTCTCTCCCACATCATTGCTCGAGCAATGATGTGGGAGAGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030064.2-321s21c1
Sequence:CCGGGCGGAGAACCATTGAGGATTTCTCGAGAAATCCTCAATGGTTCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030064.2-1547s21c1
Sequence:CCGGATTCCCAAGGGAGACGTATTTCTCGAGAAATACGTCTCCCTTGGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030064.2-1243s21c1
Sequence:CCGGTGGGATCTGATCACGTGTTACCTCGAGGTAACACGTGATCAGATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030064
VALIDATED
PHF23 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 23
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030064.2-274s21c1
Sequence:CCGGGATCCGCCTCCGACTCTTAAACTCGAGTTTAAGAGTCGGAGGCGGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030064.2-682s21c1
Sequence:CCGGCCACTCTCTCCCACATCATTGCTCGAGCAATGATGTGGGAGAGAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030064.2-321s21c1
Sequence:CCGGGCGGAGAACCATTGAGGATTTCTCGAGAAATCCTCAATGGTTCTCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030064.2-1547s21c1
Sequence:CCGGATTCCCAAGGGAGACGTATTTCTCGAGAAATACGTCTCCCTTGGGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030064.2-1243s21c1
Sequence:CCGGTGGGATCTGATCACGTGTTACCTCGAGGTAACACGTGATCAGATCCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)