EMAIL THIS PAGE TO A FRIEND

PHF2

PHD finger protein 2

135 Gene Product Result for
Synonyms: CENP-35 GRC5 JHDM1E
UniProtKB ID: O75151, Q4VXG0, Q8N3K2, Q9Y6N4
Gene ID:
Human(5253) Summary: This gene encodes a protein which contains a zinc finger-like PHD (plant homeodomain) finger, distinct from other classes of zinc finger motifs, and a hydrophobic and highly conserved domain. The PHD finger shows the typical Cys4-His-Cys3 arrangement. PHD finger genes are thought to belong to a diverse group of transcriptional regulators possibly affecting eukaryotic gene expression by influencing chromatin structure. [provided by RefSeq, Jul 2008]
Mouse(18676) PHD finger protein 2
Rat(306814) PHD finger protein 2
Zebrafish(503778) PHD finger protein 2
chicken(415981) PHD finger protein 2
dog(484208) PHD finger protein 2
domestic cat(101092898) PHD finger protein 2
domestic guinea pig(100722251) PHD finger protein 2
naked mole-rat(101698987) PHD finger protein 2
cow(537728) PHD finger protein 2
sheep(101111079) PHD finger protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011078 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011078 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011078 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005392 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005392 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005392 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005392 Rosetta Predictions human pricing
NM_024517 Rosetta Predictions human pricing
NM_001107342 Rosetta Predictions rat pricing
NM_011078 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339519 predicted 938
2 SASI_Hs01_00185572 predicted 671
3 SASI_Hs01_00185573 predicted 781
4 SASI_Hs01_00185574 predicted 2212
5 SASI_Hs02_00339520 predicted 1005
6 SASI_Hs01_00185575 predicted 1279
7 SASI_Hs01_00185576 predicted 1226
8 SASI_Hs01_00185577 predicted 1975
9 SASI_Hs01_00185579 predicted 855
10 SASI_Hs01_00185580 predicted 1143
11 SASI_Hs01_00185578 predicted 2636
12 SASI_Hs01_00185581 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018965 predicted 555
2 SASI_Hs01_00018966 predicted 658
3 SASI_Hs01_00018967 predicted 2091
4 SASI_Hs01_00018968 predicted 1161
5 SASI_Hs01_00018969 predicted 1111
6 SASI_Hs01_00018970 predicted 1861
7 SASI_Hs01_00018971 predicted 2632
8 SASI_Hs01_00018972 predicted 737
9 SASI_Hs01_00018973 predicted 1024
10 SASI_Hs01_00018974 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227885 predicted 871
2 SASI_Rn02_00227886 predicted 2437
3 SASI_Rn02_00227887 predicted 1548
4 SASI_Rn02_00227888 predicted 2379
5 SASI_Rn02_00227889 predicted 491
6 SASI_Rn02_00227890 predicted 406
7 SASI_Rn02_00227891 predicted 2167
8 SASI_Rn02_00227892 predicted 935
9 SASI_Rn02_00227893 predicted 3039
10 SASI_Rn02_00227894 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184936 predicted 943
2 SASI_Mm01_00184937 predicted 629
3 SASI_Mm01_00184938 predicted 638
4 SASI_Mm01_00184939 predicted 1256
5 SASI_Mm02_00319850 predicted 2696
6 SASI_Mm01_00184940 predicted 812
7 SASI_Mm01_00184941 predicted 1290
8 SASI_Mm01_00184942 predicted 722
9 SASI_Mm01_00184944 predicted 2594
10 SASI_Mm01_00184945 predicted 1868
11 SASI_Mm01_00184943 predicted 2133
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011078
VALIDATED
PHF2 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011078.2-5140s21c1
Sequence:CCGGCGTGGCTATTAAAGTGTTCTACTCGAGTAGAACACTTTAATAGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011078.2-637s21c1
Sequence:CCGGGCTGAAAGAATTCGTGGACTACTCGAGTAGTCCACGAATTCTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011078.2-2159s21c1
Sequence:CCGGGAGCTGAAGATAGACGAGTTTCTCGAGAAACTCGTCTATCTTCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011078.2-1296s21c1
Sequence:CCGGCACACTTAGTTCAAGGAGCTACTCGAGTAGCTCCTTGAACTAAGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011078.2-743s21c1
Sequence:CCGGCCTGACATTGTGAAGAAACTACTCGAGTAGTTTCTTCACAATGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011078.2-1296s1c1
Sequence:CCGGCACACTTAGTTCAAGGAGCTACTCGAGTAGCTCCTTGAACTAAGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011078.2-5140s1c1
Sequence:CCGGCGTGGCTATTAAAGTGTTCTACTCGAGTAGAACACTTTAATAGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011078.2-743s1c1
Sequence:CCGGCCTGACATTGTGAAGAAACTACTCGAGTAGTTTCTTCACAATGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011078.2-2159s1c1
Sequence:CCGGGAGCTGAAGATAGACGAGTTTCTCGAGAAACTCGTCTATCTTCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011078.2-637s1c1
Sequence:CCGGGCTGAAAGAATTCGTGGACTACTCGAGTAGTCCACGAATTCTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011078
VALIDATED
PHF2 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011078.2-5140s21c1
Sequence:CCGGCGTGGCTATTAAAGTGTTCTACTCGAGTAGAACACTTTAATAGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011078.2-637s21c1
Sequence:CCGGGCTGAAAGAATTCGTGGACTACTCGAGTAGTCCACGAATTCTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011078.2-2159s21c1
Sequence:CCGGGAGCTGAAGATAGACGAGTTTCTCGAGAAACTCGTCTATCTTCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011078.2-1296s21c1
Sequence:CCGGCACACTTAGTTCAAGGAGCTACTCGAGTAGCTCCTTGAACTAAGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011078.2-743s21c1
Sequence:CCGGCCTGACATTGTGAAGAAACTACTCGAGTAGTTTCTTCACAATGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011078.2-1296s1c1
Sequence:CCGGCACACTTAGTTCAAGGAGCTACTCGAGTAGCTCCTTGAACTAAGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011078.2-5140s1c1
Sequence:CCGGCGTGGCTATTAAAGTGTTCTACTCGAGTAGAACACTTTAATAGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011078.2-743s1c1
Sequence:CCGGCCTGACATTGTGAAGAAACTACTCGAGTAGTTTCTTCACAATGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011078.2-2159s1c1
Sequence:CCGGGAGCTGAAGATAGACGAGTTTCTCGAGAAACTCGTCTATCTTCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011078.2-637s1c1
Sequence:CCGGGCTGAAAGAATTCGTGGACTACTCGAGTAGTCCACGAATTCTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011078
VALIDATED
PHF2 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011078.2-5140s21c1
Sequence:CCGGCGTGGCTATTAAAGTGTTCTACTCGAGTAGAACACTTTAATAGCCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011078.2-637s21c1
Sequence:CCGGGCTGAAAGAATTCGTGGACTACTCGAGTAGTCCACGAATTCTTTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011078.2-2159s21c1
Sequence:CCGGGAGCTGAAGATAGACGAGTTTCTCGAGAAACTCGTCTATCTTCAGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011078.2-1296s21c1
Sequence:CCGGCACACTTAGTTCAAGGAGCTACTCGAGTAGCTCCTTGAACTAAGTGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011078.2-743s21c1
Sequence:CCGGCCTGACATTGTGAAGAAACTACTCGAGTAGTTTCTTCACAATGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011078.2-1296s1c1
Sequence:CCGGCACACTTAGTTCAAGGAGCTACTCGAGTAGCTCCTTGAACTAAGTGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011078.2-5140s1c1
Sequence:CCGGCGTGGCTATTAAAGTGTTCTACTCGAGTAGAACACTTTAATAGCCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011078.2-743s1c1
Sequence:CCGGCCTGACATTGTGAAGAAACTACTCGAGTAGTTTCTTCACAATGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011078.2-2159s1c1
Sequence:CCGGGAGCTGAAGATAGACGAGTTTCTCGAGAAACTCGTCTATCTTCAGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011078.2-637s1c1
Sequence:CCGGGCTGAAAGAATTCGTGGACTACTCGAGTAGTCCACGAATTCTTTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005392
VALIDATED
PHF2 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005392.3-669s21c1
Sequence:GTACCGGGAAGGAGTTTGTGGACTATTACTCGAGTAATAGTCCACAAACTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005392.3-2201s21c1
Sequence:CCGGAGCTCAAGATCGACGAGTTTCCTCGAGGAAACTCGTCGATCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005392.3-1031s21c1
Sequence:CCGGTTGCTGACCAGGTCGACAAATCTCGAGATTTGTCGACCTGGTCAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005392.3-314s21c1
Sequence:CCGGCCCATGGGAAGTCCACCTTAACTCGAGTTAAGGTGGACTTCCCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005392.2-1164s1c1
Sequence:CCGGGCATTCAAAGGCTCTCACAAACTCGAGTTTGTGAGAGCCTTTGAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005392.3-4464s21c1
Sequence:GTACCGGCATAGAATGTAGCGTGTAAATCTCGAGATTTACACGCTACATTCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005392.2-660s1c1
Sequence:CCGGGTAAAGAAACTGTCATGGGTACTCGAGTACCCATGACAGTTTCTTTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005392.2-2012s1c1
Sequence:CCGGGCAGAACTTCAAGGAGGACAACTCGAGTTGTCCTCCTTGAAGTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005392.2-2687s1c1
Sequence:CCGGCATCTTTAAGTCCCGGTCGAACTCGAGTTCGACCGGGACTTAAAGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005392.2-3311s1c1
Sequence:CCGGGAACGGGAAACTACTCCTTTACTCGAGTAAAGGAGTAGTTTCCCGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005392
VALIDATED
PHF2 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005392.3-669s21c1
Sequence:GTACCGGGAAGGAGTTTGTGGACTATTACTCGAGTAATAGTCCACAAACTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005392.3-2201s21c1
Sequence:CCGGAGCTCAAGATCGACGAGTTTCCTCGAGGAAACTCGTCGATCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005392.3-1031s21c1
Sequence:CCGGTTGCTGACCAGGTCGACAAATCTCGAGATTTGTCGACCTGGTCAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005392.3-314s21c1
Sequence:CCGGCCCATGGGAAGTCCACCTTAACTCGAGTTAAGGTGGACTTCCCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005392.2-1164s1c1
Sequence:CCGGGCATTCAAAGGCTCTCACAAACTCGAGTTTGTGAGAGCCTTTGAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005392.3-4464s21c1
Sequence:GTACCGGCATAGAATGTAGCGTGTAAATCTCGAGATTTACACGCTACATTCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005392.2-660s1c1
Sequence:CCGGGTAAAGAAACTGTCATGGGTACTCGAGTACCCATGACAGTTTCTTTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005392.2-2012s1c1
Sequence:CCGGGCAGAACTTCAAGGAGGACAACTCGAGTTGTCCTCCTTGAAGTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005392.2-2687s1c1
Sequence:CCGGCATCTTTAAGTCCCGGTCGAACTCGAGTTCGACCGGGACTTAAAGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005392.2-3311s1c1
Sequence:CCGGGAACGGGAAACTACTCCTTTACTCGAGTAAAGGAGTAGTTTCCCGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005392
VALIDATED
PHF2 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005392.3-669s21c1
Sequence:GTACCGGGAAGGAGTTTGTGGACTATTACTCGAGTAATAGTCCACAAACTCCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005392.3-2201s21c1
Sequence:CCGGAGCTCAAGATCGACGAGTTTCCTCGAGGAAACTCGTCGATCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005392.3-1031s21c1
Sequence:CCGGTTGCTGACCAGGTCGACAAATCTCGAGATTTGTCGACCTGGTCAGCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005392.3-314s21c1
Sequence:CCGGCCCATGGGAAGTCCACCTTAACTCGAGTTAAGGTGGACTTCCCATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005392.2-1164s1c1
Sequence:CCGGGCATTCAAAGGCTCTCACAAACTCGAGTTTGTGAGAGCCTTTGAATGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005392.3-4464s21c1
Sequence:GTACCGGCATAGAATGTAGCGTGTAAATCTCGAGATTTACACGCTACATTCTATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005392.2-660s1c1
Sequence:CCGGGTAAAGAAACTGTCATGGGTACTCGAGTACCCATGACAGTTTCTTTACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005392.2-2012s1c1
Sequence:CCGGGCAGAACTTCAAGGAGGACAACTCGAGTTGTCCTCCTTGAAGTTCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005392.2-2687s1c1
Sequence:CCGGCATCTTTAAGTCCCGGTCGAACTCGAGTTCGACCGGGACTTAAAGATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_005392.2-3311s1c1
Sequence:CCGGGAACGGGAAACTACTCCTTTACTCGAGTAAAGGAGTAGTTTCCCGTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)