EMAIL THIS PAGE TO A FRIEND

PHF3

PHD finger protein 3

182 Gene Product Result for
Gene ID:
Mouse(213109) PHD finger protein 3
Rat(363210) PHD finger protein 3
Zebrafish(553518) PHD finger protein 3
domestic cat(101082655) PHD finger protein 3
Horse(100057084) PHD finger protein 3
dog(481864) PHD finger protein 3
chicken(428641) PHD finger protein 3
domestic guinea pig(100730424) PHD finger protein 3
naked mole-rat(101724766) PHD finger protein 3
Domestic Rabbit(100339568) PHD finger protein 3
cow(522928) PHD finger protein 3
sheep(101110245) PHD finger protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015153 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081080 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081080 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081080 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015153 Rosetta Predictions human pricing
NM_001108791 Rosetta Predictions rat pricing
NM_001081080 Rosetta Predictions mouse pricing
XM_129836 Rosetta Predictions mouse pricing
XM_897637 Rosetta Predictions mouse pricing
XM_897648 Rosetta Predictions mouse pricing
XM_897656 Rosetta Predictions mouse pricing
XM_897672 Rosetta Predictions mouse pricing
XM_897697 Rosetta Predictions mouse pricing
XM_980418 Rosetta Predictions mouse pricing
XM_980449 Rosetta Predictions mouse pricing
XM_980481 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347106 predicted 3780
2 SASI_Hs02_00347107 predicted 4840
3 SASI_Hs01_00136964 predicted 263
4 SASI_Hs01_00136965 predicted 4046
5 SASI_Hs01_00136967 predicted 4038
6 SASI_Hs01_00136968 predicted 1439
7 SASI_Hs02_00347108 predicted 1414
8 SASI_Hs01_00136969 predicted 6206
9 SASI_Hs01_00136970 predicted 1222
10 SASI_Hs02_00347109 predicted 1404
11 SASI_Hs01_00136962 predicted 733
12 SASI_Hs01_00136963 predicted 2847
13 SASI_Hs01_00136966 predicted 1699
14 SASI_Hs01_00136971 predicted 5631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108791 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242105 predicted 4311
2 SASI_Rn02_00242106 predicted 2565
3 SASI_Rn02_00242107 predicted 862
4 SASI_Rn02_00242108 predicted 5524
5 SASI_Rn02_00242109 predicted 776
6 SASI_Rn02_00242110 predicted 3886
7 SASI_Rn02_00242111 predicted 1524
8 SASI_Rn02_00242112 predicted 5777
9 SASI_Rn02_00242113 predicted 4041
10 SASI_Rn02_00242114 predicted 1557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294981 predicted 5272
2 SASI_Mm02_00294982 predicted 5290
3 SASI_Mm02_00294983 predicted 1340
4 SASI_Mm02_00294984 predicted 3195
5 SASI_Mm02_00294985 predicted 511
6 SASI_Mm02_00294986 predicted 266
7 SASI_Mm02_00294987 predicted 851
8 SASI_Mm02_00294988 predicted 4583
9 SASI_Mm02_00294989 predicted 450
10 SASI_Mm02_00294990 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285441 predicted 5276
2 SASI_Mm01_00285442 predicted 5288
3 SASI_Mm01_00285443 predicted 3203
4 SASI_Mm01_00285444 predicted 522
5 SASI_Mm01_00285445 predicted 861
6 SASI_Mm01_00285446 predicted 4591
7 SASI_Mm01_00285447 predicted 461
8 SASI_Mm01_00285448 predicted 913
9 SASI_Mm01_00285449 predicted 1490
10 SASI_Mm01_00285450 predicted 1755
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897637 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241382 predicted 3591
2 SASI_Mm01_00241383 predicted 3602
3 SASI_Mm01_00241384 predicted 1513
4 SASI_Mm01_00241385 predicted 2891
5 SASI_Mm01_00241386 predicted 2899
6 SASI_Mm01_00241387 predicted 1705
7 SASI_Mm01_00241388 predicted 2736
8 SASI_Mm01_00241389 predicted 1717
9 SASI_Mm01_00241390 predicted 4477
10 SASI_Mm01_00241391 predicted 2012
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897648 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230683 predicted 441
2 SASI_Mm01_00230684 predicted 1059
3 SASI_Mm01_00230685 predicted 935
4 SASI_Mm01_00230686 predicted 972
5 SASI_Mm01_00230687 predicted 913
6 SASI_Mm01_00230688 predicted 899
7 SASI_Mm01_00230689 predicted 315
8 SASI_Mm01_00230690 predicted 635
9 SASI_Mm01_00230691 predicted 678
10 SASI_Mm01_00230692 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897656 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216937 predicted 436
2 SASI_Mm01_00216938 predicted 521
3 SASI_Mm01_00216939 predicted 865
4 SASI_Mm01_00216940 predicted 845
5 SASI_Mm01_00216941 predicted 370
6 SASI_Mm01_00216942 predicted 458
7 SASI_Mm01_00216943 predicted 232
8 SASI_Mm01_00216944 predicted 906
9 SASI_Mm01_00216945 predicted 1497
10 SASI_Mm01_00216946 predicted 1387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260943 predicted 3197
2 SASI_Mm01_00260944 predicted 435
3 SASI_Mm01_00260945 predicted 517
4 SASI_Mm01_00260946 predicted 862
5 SASI_Mm01_00260947 predicted 465
6 SASI_Mm01_00260948 predicted 912
7 SASI_Mm01_00260949 predicted 1496
8 SASI_Mm01_00260950 predicted 1383
9 SASI_Mm01_00260951 predicted 1748
10 SASI_Mm01_00260952 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281808 predicted 3205
2 SASI_Mm01_00281809 predicted 434
3 SASI_Mm01_00281810 predicted 521
4 SASI_Mm01_00281811 predicted 864
5 SASI_Mm01_00281812 predicted 462
6 SASI_Mm01_00281813 predicted 230
7 SASI_Mm01_00281814 predicted 913
8 SASI_Mm01_00281815 predicted 1494
9 SASI_Mm01_00281816 predicted 1390
10 SASI_Mm01_00281817 predicted 1751
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246617 predicted 1897
2 SASI_Mm01_00246618 predicted 1913
3 SASI_Mm01_00246619 predicted 2628
4 SASI_Mm01_00246620 predicted 1205
5 SASI_Mm01_00246621 predicted 1216
6 SASI_Mm01_00246622 predicted 604
7 SASI_Mm01_00246623 predicted 1047
8 SASI_Mm01_00246624 predicted 600
9 SASI_Mm01_00246625 predicted 2790
10 SASI_Mm01_00246626 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277728 predicted 2281
2 SASI_Mm01_00277729 predicted 2291
3 SASI_Mm01_00277730 predicted 1577
4 SASI_Mm01_00277731 predicted 1593
5 SASI_Mm01_00277732 predicted 400
6 SASI_Mm01_00277733 predicted 1437
7 SASI_Mm01_00277734 predicted 415
8 SASI_Mm01_00277735 predicted 3170
9 SASI_Mm01_00277736 predicted 713
10 SASI_Mm01_00277737 predicted 2478
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980481 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268984 predicted 2474
2 SASI_Mm01_00268985 predicted 2479
3 SASI_Mm01_00268986 predicted 1768
4 SASI_Mm01_00268987 predicted 1780
5 SASI_Mm01_00268988 predicted 589
6 SASI_Mm01_00268989 predicted 1619
7 SASI_Mm01_00268990 predicted 597
8 SASI_Mm01_00268991 predicted 3355
9 SASI_Mm01_00268992 predicted 891
10 SASI_Mm01_00268993 predicted 2669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015153
VALIDATED
PHF3 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015153.2-1557s21c1
Sequence:CCGGGCAGCAAAGTATGAAGTAATACTCGAGTATTACTTCATACTTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015153.2-4045s21c1
Sequence:CCGGATCTATTGTTGGGCTTAATTACTCGAGTAATTAAGCCCAACAATAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015153.2-1445s21c1
Sequence:CCGGCCAGTCAAGTAGCGTTTCTTACTCGAGTAAGAAACGCTACTTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015153.1-1558s1c1
Sequence:CCGGGCAGCAAAGTATGAAGTAATACTCGAGTATTACTTCATACTTTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015153.1-1446s1c1
Sequence:CCGGCCAGTCAAGTAGCGTTTCTTACTCGAGTAAGAAACGCTACTTGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_015153.1-5748s1c1
Sequence:CCGGGCAACTGGATAGGCCATTTAACTCGAGTTAAATGGCCTATCCAGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015153.1-415s1c1
Sequence:CCGGCCTCGTTTAATGGCACAAGAACTCGAGTTCTTGTGCCATTAAACGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015153.2-5747s21c1
Sequence:CCGGGCAACTGGATAGGCCATTTAACTCGAGTTAAATGGCCTATCCAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015153
VALIDATED
PHF3 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015153.2-1557s21c1
Sequence:CCGGGCAGCAAAGTATGAAGTAATACTCGAGTATTACTTCATACTTTGCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000274376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015153.2-4045s21c1
Sequence:CCGGATCTATTGTTGGGCTTAATTACTCGAGTAATTAAGCCCAACAATAGATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000274412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015153.2-1445s21c1
Sequence:CCGGCCAGTCAAGTAGCGTTTCTTACTCGAGTAAGAAACGCTACTTGACTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000019117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015153.1-1558s1c1
Sequence:CCGGGCAGCAAAGTATGAAGTAATACTCGAGTATTACTTCATACTTTGCTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000019115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015153.1-1446s1c1
Sequence:CCGGCCAGTCAAGTAGCGTTTCTTACTCGAGTAAGAAACGCTACTTGACTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000019118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_015153.1-5748s1c1
Sequence:CCGGGCAACTGGATAGGCCATTTAACTCGAGTTAAATGGCCTATCCAGTTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000019116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015153.1-415s1c1
Sequence:CCGGCCTCGTTTAATGGCACAAGAACTCGAGTTCTTGTGCCATTAAACGAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000274413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015153.2-5747s21c1
Sequence:CCGGGCAACTGGATAGGCCATTTAACTCGAGTTAAATGGCCTATCCAGTTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015153
VALIDATED
PHF3 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 3
Human
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000274375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015153.2-1557s21c1
Sequence:CCGGGCAGCAAAGTATGAAGTAATACTCGAGTATTACTTCATACTTTGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015153.2-4045s21c1
Sequence:CCGGATCTATTGTTGGGCTTAATTACTCGAGTAATTAAGCCCAACAATAGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015153.2-1445s21c1
Sequence:CCGGCCAGTCAAGTAGCGTTTCTTACTCGAGTAAGAAACGCTACTTGACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015153.1-1558s1c1
Sequence:CCGGGCAGCAAAGTATGAAGTAATACTCGAGTATTACTTCATACTTTGCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015153.1-1446s1c1
Sequence:CCGGCCAGTCAAGTAGCGTTTCTTACTCGAGTAAGAAACGCTACTTGACTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_015153.1-5748s1c1
Sequence:CCGGGCAACTGGATAGGCCATTTAACTCGAGTTAAATGGCCTATCCAGTTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015153.1-415s1c1
Sequence:CCGGCCTCGTTTAATGGCACAAGAACTCGAGTTCTTGTGCCATTAAACGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015153.2-5747s21c1
Sequence:CCGGGCAACTGGATAGGCCATTTAACTCGAGTTAAATGGCCTATCCAGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081080
VALIDATED
PHF3 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081080.1-69s21c1
Sequence:CCGGCACTTAGATGATGCCCTATTTCTCGAGAAATAGGGCATCATCTAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081080.1-6531s21c1
Sequence:CCGGCCGATGAGACCATACTATTTACTCGAGTAAATAGTATGGTCTCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081080.1-272s21c1
Sequence:CCGGTGTTGGTCTTGACGATATTATCTCGAGATAATATCGTCAAGACCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081080.1-861s21c1
Sequence:CCGGACTAACAGTAGCCCGTTATTTCTCGAGAAATAACGGGCTACTGTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081080.1-2389s21c1
Sequence:CCGGACGCAGTCACTGACGATAAACCTCGAGGTTTATCGTCAGTGACTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081080
VALIDATED
PHF3 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081080.1-69s21c1
Sequence:CCGGCACTTAGATGATGCCCTATTTCTCGAGAAATAGGGCATCATCTAAGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000238715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081080.1-6531s21c1
Sequence:CCGGCCGATGAGACCATACTATTTACTCGAGTAAATAGTATGGTCTCATCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000238713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081080.1-272s21c1
Sequence:CCGGTGTTGGTCTTGACGATATTATCTCGAGATAATATCGTCAAGACCAACATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000238711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081080.1-861s21c1
Sequence:CCGGACTAACAGTAGCCCGTTATTTCTCGAGAAATAACGGGCTACTGTTAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000238714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081080.1-2389s21c1
Sequence:CCGGACGCAGTCACTGACGATAAACCTCGAGGTTTATCGTCAGTGACTGCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081080
VALIDATED
PHF3 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 3
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000238712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081080.1-69s21c1
Sequence:CCGGCACTTAGATGATGCCCTATTTCTCGAGAAATAGGGCATCATCTAAGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081080.1-6531s21c1
Sequence:CCGGCCGATGAGACCATACTATTTACTCGAGTAAATAGTATGGTCTCATCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081080.1-272s21c1
Sequence:CCGGTGTTGGTCTTGACGATATTATCTCGAGATAATATCGTCAAGACCAACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081080.1-861s21c1
Sequence:CCGGACTAACAGTAGCCCGTTATTTCTCGAGAAATAACGGGCTACTGTTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081080.1-2389s21c1
Sequence:CCGGACGCAGTCACTGACGATAAACCTCGAGGTTTATCGTCAGTGACTGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)