EMAIL THIS PAGE TO A FRIEND

PHF6

PHD finger protein 6

283 Gene Product Result for
Synonyms: BFLS BORJ CENP-31
UniProtKB ID: Q8IWS0, D3DTG3, Q5JRC7, Q5JRC8, Q96JK3, Q9BRU0
Gene ID:
Human(84295) Summary: This gene is a member of the plant homeodomain (PHD)-like finger (PHF) family. It encodes a protein with two PHD-type zinc finger domains, indicating a potential role in transcriptional regulation, that localizes to the nucleolus. Mutations affecting the coding region of this gene or the splicing of the transcript have been associated with Borjeson-Forssman-Lehmann syndrome (BFLS), a disorder characterized by mental retardation, epilepsy, hypogonadism, hypometabolism, obesity, swelling of subcutaneous tissue of the face, narrow palpebral fissures, and large ears. Alternate splicing results in multiple transcript variants, encoding different isoforms. [provided by RefSeq, Jun 2010]
Mouse(70998) PHD finger protein 6
Rat(100359714) PHD finger protein 6
Zebrafish(327070) PHD finger protein 6
dog(612921) PHD finger protein 6
Horse(100054177) PHD finger protein 6
domestic cat(101087647) PHD finger protein 6
chicken(422235) PHD finger protein 6
cow(518186) PHD finger protein 6
sheep(101108724) PHD finger protein 6
domestic guinea pig(100722400) PHD finger protein 6
naked mole-rat(101713183) PHD finger protein 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027642 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027642 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027642 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032335 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015877 Rosetta Predictions human pricing
NM_032335 Rosetta Predictions human pricing
NM_032458 Rosetta Predictions human pricing
NM_027642 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098326 predicted 274
2 SASI_Hs01_00098327 predicted 276
3 SASI_Hs01_00098328 predicted 273
4 SASI_Hs01_00098329 predicted 223
5 SASI_Hs01_00098330 predicted 369
6 SASI_Hs01_00098331 predicted 222
7 SASI_Hs02_00306663 predicted 204
8 SASI_Hs01_00098332 predicted 324
9 SASI_Hs01_00098333 predicted 223
10 SASI_Hs02_00306664 predicted 323
11 SASI_Hs01_00098334 predicted 290
12 SASI_Hs01_00098335 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069392 predicted 277
2 SASI_Hs01_00069393 predicted 276
3 SASI_Hs01_00069394 predicted 278
4 SASI_Hs01_00069395 predicted 226
5 SASI_Hs01_00069396 predicted 367
6 SASI_Hs01_00069397 predicted 228
7 SASI_Hs02_00359717 predicted 200
8 SASI_Hs01_00069398 predicted 323
9 SASI_Hs01_00069399 predicted 222
10 SASI_Hs02_00359718 predicted 317
11 SASI_Hs01_00069400 predicted 286
12 SASI_Hs01_00069401 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116370 predicted 271
2 SASI_Hs01_00116371 predicted 281
3 SASI_Hs01_00116372 predicted 273
4 SASI_Hs01_00116373 predicted 229
5 SASI_Hs01_00116374 predicted 368
6 SASI_Hs01_00116375 predicted 228
7 SASI_Hs02_00359895 predicted 201
8 SASI_Hs01_00116376 predicted 318
9 SASI_Hs01_00116377 predicted 223
10 SASI_Hs02_00359896 predicted 320
11 SASI_Hs01_00116378 predicted 292
12 SASI_Hs01_00116379 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027642 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158229 predicted 981
2 SASI_Mm01_00158230 predicted 628
3 SASI_Mm01_00158231 predicted 1164
4 SASI_Mm02_00332523 predicted 886
5 SASI_Mm02_00332524 predicted 364
6 SASI_Mm01_00158232 predicted 823
7 SASI_Mm02_00332525 predicted 617
8 SASI_Mm01_00158235 predicted 1129
9 SASI_Mm02_00332526 predicted 885
10 SASI_Mm01_00158237 predicted 1349
11 SASI_Mm01_00158233 predicted 565
12 SASI_Mm01_00158234 predicted 446
13 SASI_Mm01_00158236 predicted 585
14 SASI_Mm01_00158238 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027642
VALIDATED
PHF6 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 6
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-1283s21c1
Sequence:CCGGCTAACCCAGCAGCAGCTTAATCTCGAGATTAAGCTGCTGCTGGGTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-532s21c1
Sequence:CCGGCCACTGTGCATTGCATGATAACTCGAGTTATCATGCAATGCACAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-624s21c1
Sequence:CCGGATAACTCGGAAGCTGATTTAGCTCGAGCTAAATCAGCTTCCGAGTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-888s21c1
Sequence:CCGGCAAGAGGGAAATTGCATATATCTCGAGATATATGCAATTTCCCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-832s21c1
Sequence:CCGGTAATGATACCAGGCCTAAATGCTCGAGCATTTAGGCCTGGTATCATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-247s21c1
Sequence:CCGGGTCTACGAGACAGCGTAAATGCTCGAGCATTTACGCTGTCTCGTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027642.1-928s1c1
Sequence:CCGGCGCACATTACAAGTGCATGTTCTCGAGAACATGCACTTGTAATGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-992s21c1
Sequence:CCGGGAATTTGGAGATTTCGATATTCTCGAGAATATCGAAATCTCCAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027642.1-1172s1c1
Sequence:CCGGCGAGGAATTTACAAACTCTATCTCGAGATAGAGTTTGTAAATTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027642.1-576s1c1
Sequence:CCGGCGCAAGGGATTTACATGGTTTCTCGAGAAACCATGTAAATCCCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027642.1-1484s1c1
Sequence:CCGGGCCGAATTTGACATATTGATACTCGAGTATCAATATGTCAAATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027642.1-578s1c1
Sequence:CCGGCAAGGGATTTACATGGTTTATCTCGAGATAAACCATGTAAATCCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027642
VALIDATED
PHF6 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 6
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-1283s21c1
Sequence:CCGGCTAACCCAGCAGCAGCTTAATCTCGAGATTAAGCTGCTGCTGGGTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-532s21c1
Sequence:CCGGCCACTGTGCATTGCATGATAACTCGAGTTATCATGCAATGCACAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-624s21c1
Sequence:CCGGATAACTCGGAAGCTGATTTAGCTCGAGCTAAATCAGCTTCCGAGTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-888s21c1
Sequence:CCGGCAAGAGGGAAATTGCATATATCTCGAGATATATGCAATTTCCCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-832s21c1
Sequence:CCGGTAATGATACCAGGCCTAAATGCTCGAGCATTTAGGCCTGGTATCATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-247s21c1
Sequence:CCGGGTCTACGAGACAGCGTAAATGCTCGAGCATTTACGCTGTCTCGTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027642.1-928s1c1
Sequence:CCGGCGCACATTACAAGTGCATGTTCTCGAGAACATGCACTTGTAATGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-992s21c1
Sequence:CCGGGAATTTGGAGATTTCGATATTCTCGAGAATATCGAAATCTCCAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027642.1-1172s1c1
Sequence:CCGGCGAGGAATTTACAAACTCTATCTCGAGATAGAGTTTGTAAATTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027642.1-576s1c1
Sequence:CCGGCGCAAGGGATTTACATGGTTTCTCGAGAAACCATGTAAATCCCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027642.1-1484s1c1
Sequence:CCGGGCCGAATTTGACATATTGATACTCGAGTATCAATATGTCAAATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027642.1-578s1c1
Sequence:CCGGCAAGGGATTTACATGGTTTATCTCGAGATAAACCATGTAAATCCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027642
VALIDATED
PHF6 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 6
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-1283s21c1
Sequence:CCGGCTAACCCAGCAGCAGCTTAATCTCGAGATTAAGCTGCTGCTGGGTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-532s21c1
Sequence:CCGGCCACTGTGCATTGCATGATAACTCGAGTTATCATGCAATGCACAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-624s21c1
Sequence:CCGGATAACTCGGAAGCTGATTTAGCTCGAGCTAAATCAGCTTCCGAGTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-888s21c1
Sequence:CCGGCAAGAGGGAAATTGCATATATCTCGAGATATATGCAATTTCCCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-832s21c1
Sequence:CCGGTAATGATACCAGGCCTAAATGCTCGAGCATTTAGGCCTGGTATCATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-247s21c1
Sequence:CCGGGTCTACGAGACAGCGTAAATGCTCGAGCATTTACGCTGTCTCGTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027642.1-928s1c1
Sequence:CCGGCGCACATTACAAGTGCATGTTCTCGAGAACATGCACTTGTAATGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027642.1-992s21c1
Sequence:CCGGGAATTTGGAGATTTCGATATTCTCGAGAATATCGAAATCTCCAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027642.1-1172s1c1
Sequence:CCGGCGAGGAATTTACAAACTCTATCTCGAGATAGAGTTTGTAAATTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027642.1-576s1c1
Sequence:CCGGCGCAAGGGATTTACATGGTTTCTCGAGAAACCATGTAAATCCCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027642.1-1484s1c1
Sequence:CCGGGCCGAATTTGACATATTGATACTCGAGTATCAATATGTCAAATTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027642.1-578s1c1
Sequence:CCGGCAAGGGATTTACATGGTTTATCTCGAGATAAACCATGTAAATCCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032335
VALIDATED
PHF6 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 6
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032335.3-231s21c1
Sequence:CCGGGGCCTACAAGACAGCGCAAATCTCGAGATTTGCGCTGTCTTGTAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032335.3-1004s21c1
Sequence:CCGGACTGTACTTCAGGAGATTAAACTCGAGTTTAATCTCCTGAAGTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032335.3-612s21c1
Sequence:CCGGACTCCGAAGCAGCTGATTTAGCTCGAGCTAAATCAGCTGCTTCGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032335.3-820s21c1
Sequence:CCGGTAGTGACACCAGGCCTAAATGCTCGAGCATTTAGGCCTGGTGTCACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032335.1-302s1c1
Sequence:CCGGCATCACACTCTGATAATGAAACTCGAGTTTCATTATCAGAGTGTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032335.3-906s21c1
Sequence:CCGGAGAAGGCAGCTGCCCATTATACTCGAGTATAATGGGCAGCTGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032335.3-565s21c1
Sequence:CCGGAGGAATTTACATGGTCTATTGCTCGAGCAATAGACCATGTAAATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_032335.1-264s1c1
Sequence:CCGGGCACCATAAGTGCATGCTCTTCTCGAGAAGAGCATGCACTTATGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_032335.1-858s1c1
Sequence:CCGGCCATTATAAGTGCATGTTGTTCTCGAGAACAACATGCACTTATAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_032335.1-456s1c1
Sequence:CCGGCCACTGTGCATTGCATGATAACTCGAGTTATCATGCAATGCACAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_032335.1-917s1c1
Sequence:CCGGCAGAATTTGGAGACTTTGATACTCGAGTATCAAAGTCTCCAAATTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032335
VALIDATED
PHF6 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 6
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032335.3-231s21c1
Sequence:CCGGGGCCTACAAGACAGCGCAAATCTCGAGATTTGCGCTGTCTTGTAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032335.3-1004s21c1
Sequence:CCGGACTGTACTTCAGGAGATTAAACTCGAGTTTAATCTCCTGAAGTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032335.3-612s21c1
Sequence:CCGGACTCCGAAGCAGCTGATTTAGCTCGAGCTAAATCAGCTGCTTCGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032335.3-820s21c1
Sequence:CCGGTAGTGACACCAGGCCTAAATGCTCGAGCATTTAGGCCTGGTGTCACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032335.1-302s1c1
Sequence:CCGGCATCACACTCTGATAATGAAACTCGAGTTTCATTATCAGAGTGTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032335.3-906s21c1
Sequence:CCGGAGAAGGCAGCTGCCCATTATACTCGAGTATAATGGGCAGCTGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032335.3-565s21c1
Sequence:CCGGAGGAATTTACATGGTCTATTGCTCGAGCAATAGACCATGTAAATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_032335.1-264s1c1
Sequence:CCGGGCACCATAAGTGCATGCTCTTCTCGAGAAGAGCATGCACTTATGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_032335.1-858s1c1
Sequence:CCGGCCATTATAAGTGCATGTTGTTCTCGAGAACAACATGCACTTATAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_032335.1-456s1c1
Sequence:CCGGCCACTGTGCATTGCATGATAACTCGAGTTATCATGCAATGCACAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_032335.1-917s1c1
Sequence:CCGGCAGAATTTGGAGACTTTGATACTCGAGTATCAAAGTCTCCAAATTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032335
VALIDATED
PHF6 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 6
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032335.3-231s21c1
Sequence:CCGGGGCCTACAAGACAGCGCAAATCTCGAGATTTGCGCTGTCTTGTAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032335.3-1004s21c1
Sequence:CCGGACTGTACTTCAGGAGATTAAACTCGAGTTTAATCTCCTGAAGTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032335.3-612s21c1
Sequence:CCGGACTCCGAAGCAGCTGATTTAGCTCGAGCTAAATCAGCTGCTTCGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032335.3-820s21c1
Sequence:CCGGTAGTGACACCAGGCCTAAATGCTCGAGCATTTAGGCCTGGTGTCACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032335.1-302s1c1
Sequence:CCGGCATCACACTCTGATAATGAAACTCGAGTTTCATTATCAGAGTGTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032335.3-906s21c1
Sequence:CCGGAGAAGGCAGCTGCCCATTATACTCGAGTATAATGGGCAGCTGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032335.3-565s21c1
Sequence:CCGGAGGAATTTACATGGTCTATTGCTCGAGCAATAGACCATGTAAATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_032335.1-264s1c1
Sequence:CCGGGCACCATAAGTGCATGCTCTTCTCGAGAAGAGCATGCACTTATGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_032335.1-858s1c1
Sequence:CCGGCCATTATAAGTGCATGTTGTTCTCGAGAACAACATGCACTTATAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_032335.1-456s1c1
Sequence:CCGGCCACTGTGCATTGCATGATAACTCGAGTTATCATGCAATGCACAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_032335.1-917s1c1
Sequence:CCGGCAGAATTTGGAGACTTTGATACTCGAGTATCAAAGTCTCCAAATTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)