EMAIL THIS PAGE TO A FRIEND

PHF7

PHD finger protein 7

93 Gene Product Result for
Synonyms: HSPC045 HSPC226 NYD-SP6
UniProtKB ID: Q9BWX1, K4DI82
Gene ID:
Human(51533) Summary: Spermatogenesis is a complex process regulated by extracellular and intracellular factors as well as cellular interactions among interstitial cells of the testis, Sertoli cells, and germ cells. This gene is expressed in the testis in Sertoli cells but not germ cells. The protein encoded by this gene contains plant homeodomain (PHD) finger domains, also known as leukemia associated protein (LAP) domains, believed to be involved in transcriptional regulation. The protein, which localizes to the nucleus of transfected cells, has been implicated in the transcriptional regulation of spermatogenesis. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Mouse(71838) PHD finger protein 7
Rat(364510) PHD finger protein 7
naked mole-rat(101703563) PHD finger protein 7
Domestic Rabbit(100347152) PHD finger protein 7
domestic guinea pig(100729046) PHD finger protein 7
cow(100337047) PHD finger protein 7
sheep(101111398) PHD finger protein 7
fruit fly(33015) PHD finger protein 7 ortholog
Horse(100051872) PHD finger protein 7
domestic cat(101082299) PHD finger protein 7
dog(476596) PHD finger protein 7
chicken(427822) PHD finger protein 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016483 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027949 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027949 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027949 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016483 Rosetta Predictions human pricing
NM_173341 Rosetta Predictions human pricing
NM_001012211 Rosetta Predictions rat pricing
XM_573852 Rosetta Predictions rat pricing
NM_027949 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349539 predicted 1897
2 SASI_Hs01_00171869 predicted 972
3 SASI_Hs01_00171871 predicted 955
4 SASI_Hs01_00171872 predicted 1841
5 SASI_Hs01_00171873 predicted 1117
6 SASI_Hs01_00171874 predicted 878
7 SASI_Hs01_00171875 predicted 896
8 SASI_Hs02_00349540 predicted 1950
9 SASI_Hs02_00349541 predicted 888
10 SASI_Hs01_00171878 predicted 1805
11 SASI_Hs01_00171870 predicted 832
12 SASI_Hs01_00171876 predicted 1088
13 SASI_Hs01_00171877 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368175 predicted 1784
2 SASI_Hs01_00027236 predicted 974
3 SASI_Hs01_00027238 predicted 954
4 SASI_Hs01_00027239 predicted 1725
5 SASI_Hs01_00027240 predicted 1113
6 SASI_Hs01_00027241 predicted 881
7 SASI_Hs01_00027242 predicted 898
8 SASI_Hs02_00368176 predicted 1836
9 SASI_Hs02_00368177 predicted 890
10 SASI_Hs01_00027245 predicted 1686
11 SASI_Hs01_00027237 predicted 828
12 SASI_Hs01_00027243 predicted 1080
13 SASI_Hs01_00027244 predicted 1243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048149 predicted 629
2 SASI_Rn01_00048150 predicted 551
3 SASI_Rn01_00048151 predicted 302
4 SASI_Rn01_00048152 predicted 198
5 SASI_Rn01_00048153 predicted 462
6 SASI_Rn01_00048154 predicted 1283
7 SASI_Rn01_00048155 predicted 672
8 SASI_Rn01_00048156 predicted 669
9 SASI_Rn01_00048157 predicted 1014
10 SASI_Rn01_00048158 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573852 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00161288 predicted 1096
2 SASI_Rn01_00161289 predicted 1023
3 SASI_Rn01_00161290 predicted 765
4 SASI_Rn01_00161291 predicted 667
5 SASI_Rn01_00161292 predicted 930
6 SASI_Rn01_00161293 predicted 1744
7 SASI_Rn01_00161294 predicted 1146
8 SASI_Rn01_00161295 predicted 1141
9 SASI_Rn01_00161296 predicted 1485
10 SASI_Rn01_00161297 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027949 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067436 predicted 779
2 SASI_Mm01_00067437 predicted 1164
3 SASI_Mm02_00332957 predicted 1118
4 SASI_Mm01_00067438 predicted 635
5 SASI_Mm01_00067439 predicted 1148
6 SASI_Mm01_00067440 predicted 740
7 SASI_Mm01_00067441 predicted 672
8 SASI_Mm01_00067442 predicted 985
9 SASI_Mm01_00067443 predicted 1518
10 SASI_Mm01_00067444 predicted 1207
11 SASI_Mm01_00067445 predicted 1160
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016483
PHF7 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016483.4-1387s1c1
Sequence:CCGGCCCACACATCAGCAAAGCATTCTCGAGAATGCTTTGCTGATGTGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016483.4-1364s1c1
Sequence:CCGGCCGCAAGTGCATACAGAAATACTCGAGTATTTCTGTATGCACTTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016483.4-965s21c1
Sequence:CCGGCAATATCAGCGTGCATTATTTCTCGAGAAATAATGCACGCTGATATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016483.4-987s21c1
Sequence:CCGGTGTCTTATCTTATCTAGTAAGCTCGAGCTTACTAGATAAGATAAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016483.4-1659s21c1
Sequence:CCGGTGCTCCTCTCTTAGATCTAACCTCGAGGTTAGATCTAAGAGAGGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016483
PHF7 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016483.4-1387s1c1
Sequence:CCGGCCCACACATCAGCAAAGCATTCTCGAGAATGCTTTGCTGATGTGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016483.4-1364s1c1
Sequence:CCGGCCGCAAGTGCATACAGAAATACTCGAGTATTTCTGTATGCACTTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016483.4-965s21c1
Sequence:CCGGCAATATCAGCGTGCATTATTTCTCGAGAAATAATGCACGCTGATATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016483.4-987s21c1
Sequence:CCGGTGTCTTATCTTATCTAGTAAGCTCGAGCTTACTAGATAAGATAAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016483.4-1659s21c1
Sequence:CCGGTGCTCCTCTCTTAGATCTAACCTCGAGGTTAGATCTAAGAGAGGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016483
PHF7 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016483.4-1387s1c1
Sequence:CCGGCCCACACATCAGCAAAGCATTCTCGAGAATGCTTTGCTGATGTGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016483.4-1364s1c1
Sequence:CCGGCCGCAAGTGCATACAGAAATACTCGAGTATTTCTGTATGCACTTGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016483.4-965s21c1
Sequence:CCGGCAATATCAGCGTGCATTATTTCTCGAGAAATAATGCACGCTGATATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016483.4-987s21c1
Sequence:CCGGTGTCTTATCTTATCTAGTAAGCTCGAGCTTACTAGATAAGATAAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016483.4-1659s21c1
Sequence:CCGGTGCTCCTCTCTTAGATCTAACCTCGAGGTTAGATCTAAGAGAGGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027949
VALIDATED
PHF7 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027949.1-1760s1c1
Sequence:CCGGCCCAGGACAGTGAGATACAAACTCGAGTTTGTATCTCACTGTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027949.1-1087s1c1
Sequence:CCGGCCGAACAAGTGTTGAGAACATCTCGAGATGTTCTCAACACTTGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027949.1-739s1c1
Sequence:CCGGAGACAATCTTTGTGTCCATTACTCGAGTAATGGACACAAAGATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027949.1-1456s1c1
Sequence:CCGGCAGCAAGAAATGGGAATGTAACTCGAGTTACATTCCCATTTCTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027949.1-1142s1c1
Sequence:CCGGCGCAAGTGTATCCAGAAATATCTCGAGATATTTCTGGATACACTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027949.1-1456s21c1
Sequence:CCGGCAGCAAGAAATGGGAATGTAACTCGAGTTACATTCCCATTTCTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027949.1-1087s21c1
Sequence:CCGGCCGAACAAGTGTTGAGAACATCTCGAGATGTTCTCAACACTTGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027949.1-1760s21c1
Sequence:CCGGCCCAGGACAGTGAGATACAAACTCGAGTTTGTATCTCACTGTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027949.1-739s21c1
Sequence:CCGGAGACAATCTTTGTGTCCATTACTCGAGTAATGGACACAAAGATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027949.1-1142s21c1
Sequence:CCGGCGCAAGTGTATCCAGAAATATCTCGAGATATTTCTGGATACACTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027949
VALIDATED
PHF7 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027949.1-1760s1c1
Sequence:CCGGCCCAGGACAGTGAGATACAAACTCGAGTTTGTATCTCACTGTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027949.1-1087s1c1
Sequence:CCGGCCGAACAAGTGTTGAGAACATCTCGAGATGTTCTCAACACTTGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027949.1-739s1c1
Sequence:CCGGAGACAATCTTTGTGTCCATTACTCGAGTAATGGACACAAAGATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027949.1-1456s1c1
Sequence:CCGGCAGCAAGAAATGGGAATGTAACTCGAGTTACATTCCCATTTCTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027949.1-1142s1c1
Sequence:CCGGCGCAAGTGTATCCAGAAATATCTCGAGATATTTCTGGATACACTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027949.1-1456s21c1
Sequence:CCGGCAGCAAGAAATGGGAATGTAACTCGAGTTACATTCCCATTTCTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027949.1-1087s21c1
Sequence:CCGGCCGAACAAGTGTTGAGAACATCTCGAGATGTTCTCAACACTTGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027949.1-1760s21c1
Sequence:CCGGCCCAGGACAGTGAGATACAAACTCGAGTTTGTATCTCACTGTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027949.1-739s21c1
Sequence:CCGGAGACAATCTTTGTGTCCATTACTCGAGTAATGGACACAAAGATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027949.1-1142s21c1
Sequence:CCGGCGCAAGTGTATCCAGAAATATCTCGAGATATTTCTGGATACACTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027949
VALIDATED
PHF7 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027949.1-1760s1c1
Sequence:CCGGCCCAGGACAGTGAGATACAAACTCGAGTTTGTATCTCACTGTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027949.1-1087s1c1
Sequence:CCGGCCGAACAAGTGTTGAGAACATCTCGAGATGTTCTCAACACTTGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027949.1-739s1c1
Sequence:CCGGAGACAATCTTTGTGTCCATTACTCGAGTAATGGACACAAAGATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027949.1-1456s1c1
Sequence:CCGGCAGCAAGAAATGGGAATGTAACTCGAGTTACATTCCCATTTCTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027949.1-1142s1c1
Sequence:CCGGCGCAAGTGTATCCAGAAATATCTCGAGATATTTCTGGATACACTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027949.1-1456s21c1
Sequence:CCGGCAGCAAGAAATGGGAATGTAACTCGAGTTACATTCCCATTTCTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027949.1-1087s21c1
Sequence:CCGGCCGAACAAGTGTTGAGAACATCTCGAGATGTTCTCAACACTTGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027949.1-1760s21c1
Sequence:CCGGCCCAGGACAGTGAGATACAAACTCGAGTTTGTATCTCACTGTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027949.1-739s21c1
Sequence:CCGGAGACAATCTTTGTGTCCATTACTCGAGTAATGGACACAAAGATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027949.1-1142s21c1
Sequence:CCGGCGCAAGTGTATCCAGAAATATCTCGAGATATTTCTGGATACACTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)