EMAIL THIS PAGE TO A FRIEND

PHF8

PHD finger protein 8

65 Gene Product Result for
Synonyms: JHDM1F MRXSSD ZNF422
Gene ID:
Human(23133) Summary: The protein encoded by this gene is a histone lysine demethylase that preferentially acts on histones in the monomethyl or dimethyl states. The encoded protein requires Fe(2+) ion, 2-oxoglutarate, and oxygen for its catalytic activity. Defects in this gene are a cause of mental retardation syndromic X-linked Siderius type (MRXSSD). Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Mouse(320595) PHD finger protein 8
Rat(317425) PHD finger protein 8
Zebrafish(566534) PHD finger protein 8
Horse(100060410) PHD finger protein 8
domestic cat(101092337) PHD finger protein 8
dog(491897) PHD finger protein 8
cow(513959) PHD finger protein 8
sheep(101118668) PHD finger protein 8
domestic guinea pig(100721757) PHD finger protein 8
Domestic Rabbit(100344764) PHD finger protein 8
naked mole-rat(101716284) PHD finger protein 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015107 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177201 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177201 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177201 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015107 Rosetta Predictions human pricing
NM_001108253 Rosetta Predictions rat pricing
XM_228878 Rosetta Predictions rat pricing
NM_001113354 Rosetta Predictions mouse pricing
NM_177201 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079031 predicted 243
2 SASI_Hs01_00079032 predicted 1021
3 SASI_Hs01_00079033 predicted 2034
4 SASI_Hs02_00346997 predicted 1055
5 SASI_Hs01_00079034 predicted 910
6 SASI_Hs01_00079035 predicted 1603
7 SASI_Hs01_00079036 predicted 2196
8 SASI_Hs01_00079037 predicted 1958
9 SASI_Hs02_00346998 predicted 883
10 SASI_Hs01_00079038 predicted 1013
11 SASI_Hs01_00079030 predicted 930
12 SASI_Hs01_00079039 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108253 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236834 predicted 2649
2 SASI_Rn02_00236835 predicted 1971
3 SASI_Rn02_00236836 predicted 680
4 SASI_Rn02_00236837 predicted 270
5 SASI_Rn02_00236838 predicted 1186
6 SASI_Rn02_00236839 predicted 2215
7 SASI_Rn02_00236840 predicted 1973
8 SASI_Rn02_00236841 predicted 1047
9 SASI_Rn02_00236842 predicted 854
10 SASI_Rn02_00236843 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228878 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00178505 predicted 1058
2 SASI_Rn01_00178506 predicted 488
3 SASI_Rn01_00178507 predicted 945
4 SASI_Rn01_00178508 predicted 1000
5 SASI_Rn01_00178509 predicted 484
6 SASI_Rn01_00178510 predicted 411
7 SASI_Rn01_00178511 predicted 2790
8 SASI_Rn01_00178512 predicted 1462
9 SASI_Rn01_00178513 predicted 869
10 SASI_Rn01_00178514 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113354 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307463 predicted 2918
2 SASI_Mm02_00307464 predicted 1102
3 SASI_Mm02_00307465 predicted 1800
4 SASI_Mm02_00307466 predicted 1147
5 SASI_Mm02_00307467 predicted 1668
6 SASI_Mm02_00307468 predicted 1089
7 SASI_Mm02_00307469 predicted 1019
8 SASI_Mm02_00307470 predicted 1452
9 SASI_Mm02_00307471 predicted 1561
10 SASI_Mm02_00307472 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177201 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137719 predicted 2618
2 SASI_Mm01_00137721 predicted 1100
3 SASI_Mm01_00137722 predicted 1799
4 SASI_Mm02_00347217 predicted 1150
5 SASI_Mm01_00137723 predicted 1671
6 SASI_Mm02_00347218 predicted 1088
7 SASI_Mm01_00137725 predicted 1013
8 SASI_Mm02_00347219 predicted 1452
9 SASI_Mm01_00137727 predicted 1560
10 SASI_Mm01_00137728 predicted 975
11 SASI_Mm01_00137720 predicted 2656
12 SASI_Mm01_00137724 predicted 1434
13 SASI_Mm01_00137726 predicted 1754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015107
VALIDATED
PHF8 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_015107.2-2054s21c1
Sequence:CCGGGCTGGCCAGTTGAGCTATAATCTCGAGATTATAGCTCAACTGGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015107.2-3979s21c1
Sequence:CCGGCTGCAACTCTAGCCCTATATCCTCGAGGATATAGGGCTAGAGTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015107.1-1550s1c1
Sequence:CCGGCGTTGGGAAGACGAGCAATATCTCGAGATATTGCTCGTCTTCCCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015107.1-3502s1c1
Sequence:CCGGGCAGGTAAATGGGAGAGGTTTCTCGAGAAACCTCTCCCATTTACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015107.1-1481s1c1
Sequence:CCGGGCGAACCGTACAGCTCATTAACTCGAGTTAATGAGCTGTACGGTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015107.1-1482s1c1
Sequence:CCGGCGAACCGTACAGCTCATTAAACTCGAGTTTAATGAGCTGTACGGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015107.2-1845s21c1
Sequence:CCGGACGTTGGGAAGACGAGCAATACTCGAGTATTGCTCGTCTTCCCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015107.1-360s1c1
Sequence:CCGGCCCAACTGTGAAGTCTTGCATCTCGAGATGCAAGACTTCACAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015107.1-2098s1c1
Sequence:CCGGCGACCCTGATAATAAGACCAACTCGAGTTGGTCTTATTATCAGGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015107
VALIDATED
PHF8 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_015107.2-2054s21c1
Sequence:CCGGGCTGGCCAGTTGAGCTATAATCTCGAGATTATAGCTCAACTGGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015107.2-3979s21c1
Sequence:CCGGCTGCAACTCTAGCCCTATATCCTCGAGGATATAGGGCTAGAGTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015107.1-1550s1c1
Sequence:CCGGCGTTGGGAAGACGAGCAATATCTCGAGATATTGCTCGTCTTCCCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015107.1-3502s1c1
Sequence:CCGGGCAGGTAAATGGGAGAGGTTTCTCGAGAAACCTCTCCCATTTACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015107.1-1481s1c1
Sequence:CCGGGCGAACCGTACAGCTCATTAACTCGAGTTAATGAGCTGTACGGTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015107.1-1482s1c1
Sequence:CCGGCGAACCGTACAGCTCATTAAACTCGAGTTTAATGAGCTGTACGGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015107.2-1845s21c1
Sequence:CCGGACGTTGGGAAGACGAGCAATACTCGAGTATTGCTCGTCTTCCCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015107.1-360s1c1
Sequence:CCGGCCCAACTGTGAAGTCTTGCATCTCGAGATGCAAGACTTCACAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015107.1-2098s1c1
Sequence:CCGGCGACCCTGATAATAAGACCAACTCGAGTTGGTCTTATTATCAGGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015107
VALIDATED
PHF8 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_015107.2-2054s21c1
Sequence:CCGGGCTGGCCAGTTGAGCTATAATCTCGAGATTATAGCTCAACTGGCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015107.2-3979s21c1
Sequence:CCGGCTGCAACTCTAGCCCTATATCCTCGAGGATATAGGGCTAGAGTTGCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015107.1-1550s1c1
Sequence:CCGGCGTTGGGAAGACGAGCAATATCTCGAGATATTGCTCGTCTTCCCAACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015107.1-3502s1c1
Sequence:CCGGGCAGGTAAATGGGAGAGGTTTCTCGAGAAACCTCTCCCATTTACCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015107.1-1481s1c1
Sequence:CCGGGCGAACCGTACAGCTCATTAACTCGAGTTAATGAGCTGTACGGTTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015107.1-1482s1c1
Sequence:CCGGCGAACCGTACAGCTCATTAAACTCGAGTTTAATGAGCTGTACGGTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015107.2-1845s21c1
Sequence:CCGGACGTTGGGAAGACGAGCAATACTCGAGTATTGCTCGTCTTCCCAACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015107.1-360s1c1
Sequence:CCGGCCCAACTGTGAAGTCTTGCATCTCGAGATGCAAGACTTCACAGTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015107.1-2098s1c1
Sequence:CCGGCGACCCTGATAATAAGACCAACTCGAGTTGGTCTTATTATCAGGGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177201
VALIDATED
PHF8 MISSION shRNA Bacterial Glycerol Stock
PHD finger protein 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177201.2-2735s1c1
Sequence:CCGGGCAAGCTACTTCCATGGGTTACTCGAGTAACCCATGGAAGTAGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177201.2-1817s1c1
Sequence:CCGGCGAACCTGTTAATAAGATCAACTCGAGTTGATCTTATTAACAGGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177201.2-1503s1c1
Sequence:CCGGGCGGACTGTACAGCTCATTAACTCGAGTTAATGAGCTGTACAGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177201.2-1504s1c1
Sequence:CCGGCGGACTGTACAGCTCATTAAACTCGAGTTTAATGAGCTGTACAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177201.2-734s1c1
Sequence:CCGGGCAAGATGAAACTCGGTGATTCTCGAGAATCACCGAGTTTCATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177201
VALIDATED
PHF8 MISSION shRNA shRNA Plasmid DNA
PHD finger protein 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177201.2-2735s1c1
Sequence:CCGGGCAAGCTACTTCCATGGGTTACTCGAGTAACCCATGGAAGTAGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177201.2-1817s1c1
Sequence:CCGGCGAACCTGTTAATAAGATCAACTCGAGTTGATCTTATTAACAGGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177201.2-1503s1c1
Sequence:CCGGGCGGACTGTACAGCTCATTAACTCGAGTTAATGAGCTGTACAGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177201.2-1504s1c1
Sequence:CCGGCGGACTGTACAGCTCATTAAACTCGAGTTTAATGAGCTGTACAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177201.2-734s1c1
Sequence:CCGGGCAAGATGAAACTCGGTGATTCTCGAGAATCACCGAGTTTCATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177201
VALIDATED
PHF8 MISSION shRNA Lentiviral Transduction Particles
PHD finger protein 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177201.2-2735s1c1
Sequence:CCGGGCAAGCTACTTCCATGGGTTACTCGAGTAACCCATGGAAGTAGCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177201.2-1817s1c1
Sequence:CCGGCGAACCTGTTAATAAGATCAACTCGAGTTGATCTTATTAACAGGTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177201.2-1503s1c1
Sequence:CCGGGCGGACTGTACAGCTCATTAACTCGAGTTAATGAGCTGTACAGTCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177201.2-1504s1c1
Sequence:CCGGCGGACTGTACAGCTCATTAAACTCGAGTTTAATGAGCTGTACAGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177201.2-734s1c1
Sequence:CCGGGCAAGATGAAACTCGGTGATTCTCGAGAATCACCGAGTTTCATCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)