EMAIL THIS PAGE TO A FRIEND

PHGDH

phosphoglycerate dehydrogenase

66 Gene Product Result for
Synonyms: 3-PGDH 3PGDH PDG PGAD PGD PGDH SERA
UniProtKB ID: O43175, B2RD08, Q5SZU3, Q9BQ01
Gene ID:
Human(26227) Summary: This gene encodes the enzyme which is involved in the early steps of L-serine synthesis in animal cells. L-serine is required for D-serine and other amino acid synthesis. The enzyme requires NAD/NADH as a cofactor and forms homotetramers for activity. Mutations in this gene have been found in a family with congenital microcephaly, psychomotor retardation and other symptoms. Multiple alternatively spliced transcript variants have been found, however the full-length nature of most are not known. [provided by RefSeq, Aug 2011]
Mouse(236539) 3-phosphoglycerate dehydrogenase
Rat(58835) phosphoglycerate dehydrogenase
Zebrafish(321928) phosphoglycerate dehydrogenase
chicken(424381) phosphoglycerate dehydrogenase
Horse(100059940) phosphoglycerate dehydrogenase
domestic cat(101088505) phosphoglycerate dehydrogenase
naked mole-rat(101712402) phosphoglycerate dehydrogenase
domestic guinea pig(100726801) phosphoglycerate dehydrogenase
cow(505103) phosphoglycerate dehydrogenase
sheep(101111328) phosphoglycerate dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101795 Anti-PHGDH (ab1) antibody produced in rabbit affinity isolated antibody rabbit, pig, horse, human, rat, mouse
western blot pricing
SAB2101796 Anti-PHGDH (ab2) antibody produced in rabbit affinity isolated antibody, lyophilized powder pig, rat, mouse, rabbit, human, horse, canine
western blot pricing
SAB1407294 Anti-PHGDH antibody produced in mouse purified immunoglobulin, buffered aqueous solution human, mouse
western blot pricing
SAB2108200 Anti-PHGDH antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
HPA021241 Anti-PHGDH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 Antibody Enhanced Validation human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA024031 Anti-PHGDH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunofluorescence, immunohistochemistry, western blot pricing
WH0026227M1 Monoclonal Anti-PHGDH antibody produced in mouse clone 4A3-1D6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB1405007 Monoclonal Anti-PHGDH antibody produced in mouse clone 4D5-1F11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AMAB90786 Monoclonal Anti-PHGDH antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0555, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016966 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016966 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016966 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006623 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006623 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006623 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035111 MISSION® esiRNA esiRNA human PHGDH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006623 Rosetta Predictions human pricing
NM_031620 Rosetta Predictions rat pricing
NM_016966 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041882 predicted 1323
2 SASI_Hs01_00041883 predicted 1294
3 SASI_Hs01_00041884 predicted 1255
4 SASI_Hs01_00041886 predicted 399
5 SASI_Hs01_00041887 predicted 638
6 SASI_Hs01_00041890 predicted 1531
7 SASI_Hs01_00041891 predicted 1319
8 SASI_Hs02_00341967 predicted 269
9 SASI_Hs02_00341968 predicted 457
10 SASI_Hs02_00341969 predicted 1126
11 SASI_Hs01_00041885 predicted 1433
12 SASI_Hs01_00041888 predicted 1030
13 SASI_Hs01_00041889 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031620 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037096 predicted 365
2 SASI_Rn01_00037098 predicted 991
3 SASI_Rn01_00037100 predicted 1292
4 SASI_Rn02_00264923 predicted 595
5 SASI_Rn01_00037102 predicted 1263
6 SASI_Rn01_00037103 predicted 1059
7 SASI_Rn02_00264924 predicted 307
8 SASI_Rn02_00264925 predicted 705
9 SASI_Rn01_00037104 predicted 609
10 SASI_Rn01_00037105 predicted 1098
11 SASI_Rn01_00037097 predicted 281
12 SASI_Rn01_00037099 predicted 257
13 SASI_Rn01_00037101 predicted 1530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016966 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118014 predicted 1294
2 SASI_Mm01_00118015 predicted 944
3 SASI_Mm01_00118016 predicted 1018
4 SASI_Mm02_00323818 predicted 1254
5 SASI_Mm01_00118017 predicted 1325
6 SASI_Mm01_00118018 predicted 734
7 SASI_Mm01_00118020 predicted 579
8 SASI_Mm01_00118021 predicted 1452
9 SASI_Mm01_00118022 predicted 335
10 SASI_Mm01_00118023 predicted 621
11 SASI_Mm01_00118019 predicted 645
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016966
VALIDATED
PHGDH MISSION shRNA Bacterial Glycerol Stock
phosphoglycerate dehydrogenase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016966.2-579s1c1
Sequence:CCGGCCGAATGCAATCCTTTGGAATCTCGAGATTCCAAAGGATTGCATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016966.3-1298s21c1
Sequence:CCGGCGTGAACTTGGTGAACGCTAACTCGAGTTAGCGTTCACCAAGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016966.2-1659s1c1
Sequence:CCGGGCAGCATGTATTGGAGGCTTTCTCGAGAAAGCCTCCAATACATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016966.2-259s1c1
Sequence:CCGGGCTACTAAGGTCACTGCTGATCTCGAGATCAGCAGTGACCTTAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016966.2-1254s1c1
Sequence:CCGGCGTGAACTTGGTGAACGCTAACTCGAGTTAGCGTTCACCAAGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016966.2-865s1c1
Sequence:CCGGGCACTGGATGTGTTTACAGAACTCGAGTTCTGTAAACACATCCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016966.3-303s21c1
Sequence:CCGGGCTACTAAGGTCACTGCTGATCTCGAGATCAGCAGTGACCTTAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016966.3-623s21c1
Sequence:CCGGCCGAATGCAATCCTTTGGAATCTCGAGATTCCAAAGGATTGCATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016966.3-1703s21c1
Sequence:CCGGGCAGCATGTATTGGAGGCTTTCTCGAGAAAGCCTCCAATACATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016966.3-909s21c1
Sequence:CCGGGCACTGGATGTGTTTACAGAACTCGAGTTCTGTAAACACATCCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016966
VALIDATED
PHGDH MISSION shRNA shRNA Plasmid DNA
phosphoglycerate dehydrogenase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016966.2-579s1c1
Sequence:CCGGCCGAATGCAATCCTTTGGAATCTCGAGATTCCAAAGGATTGCATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016966.3-1298s21c1
Sequence:CCGGCGTGAACTTGGTGAACGCTAACTCGAGTTAGCGTTCACCAAGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016966.2-1659s1c1
Sequence:CCGGGCAGCATGTATTGGAGGCTTTCTCGAGAAAGCCTCCAATACATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016966.2-259s1c1
Sequence:CCGGGCTACTAAGGTCACTGCTGATCTCGAGATCAGCAGTGACCTTAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016966.2-1254s1c1
Sequence:CCGGCGTGAACTTGGTGAACGCTAACTCGAGTTAGCGTTCACCAAGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016966.2-865s1c1
Sequence:CCGGGCACTGGATGTGTTTACAGAACTCGAGTTCTGTAAACACATCCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016966.3-303s21c1
Sequence:CCGGGCTACTAAGGTCACTGCTGATCTCGAGATCAGCAGTGACCTTAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016966.3-623s21c1
Sequence:CCGGCCGAATGCAATCCTTTGGAATCTCGAGATTCCAAAGGATTGCATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016966.3-1703s21c1
Sequence:CCGGGCAGCATGTATTGGAGGCTTTCTCGAGAAAGCCTCCAATACATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016966.3-909s21c1
Sequence:CCGGGCACTGGATGTGTTTACAGAACTCGAGTTCTGTAAACACATCCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016966
VALIDATED
PHGDH MISSION shRNA Lentiviral Transduction Particles
phosphoglycerate dehydrogenase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016966.2-579s1c1
Sequence:CCGGCCGAATGCAATCCTTTGGAATCTCGAGATTCCAAAGGATTGCATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016966.3-1298s21c1
Sequence:CCGGCGTGAACTTGGTGAACGCTAACTCGAGTTAGCGTTCACCAAGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016966.2-1659s1c1
Sequence:CCGGGCAGCATGTATTGGAGGCTTTCTCGAGAAAGCCTCCAATACATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016966.2-259s1c1
Sequence:CCGGGCTACTAAGGTCACTGCTGATCTCGAGATCAGCAGTGACCTTAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016966.2-1254s1c1
Sequence:CCGGCGTGAACTTGGTGAACGCTAACTCGAGTTAGCGTTCACCAAGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016966.2-865s1c1
Sequence:CCGGGCACTGGATGTGTTTACAGAACTCGAGTTCTGTAAACACATCCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016966.3-303s21c1
Sequence:CCGGGCTACTAAGGTCACTGCTGATCTCGAGATCAGCAGTGACCTTAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016966.3-623s21c1
Sequence:CCGGCCGAATGCAATCCTTTGGAATCTCGAGATTCCAAAGGATTGCATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016966.3-1703s21c1
Sequence:CCGGGCAGCATGTATTGGAGGCTTTCTCGAGAAAGCCTCCAATACATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016966.3-909s21c1
Sequence:CCGGGCACTGGATGTGTTTACAGAACTCGAGTTCTGTAAACACATCCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006623
VALIDATED
PHGDH MISSION shRNA Bacterial Glycerol Stock
phosphoglycerate dehydrogenase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_006623.2-242s1c1
Sequence:CCGGCTTAGCAAAGAGGAGCTGATACTCGAGTATCAGCTCCTCTTTGCTAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006623.3-723s21c1
Sequence:CCGGTCCTTTGGGATGAAGACTATACTCGAGTATAGTCTTCATCCCAAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_006623.2-1200s1c1
Sequence:CCGGAGGTGATAACACAGGGAACATCTCGAGATGTTCCCTGTGTTATCACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006623.2-454s1c1
Sequence:CCGGCGCAGAACTCACTTGTGGAATCTCGAGATTCCACAAGTGAGTTCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_006623.2-1622s1c1
Sequence:CCGGCAGACTTCACTGGTGTCAGATCTCGAGATCTGACACCAGTGAAGTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_006623.2-512s1c1
Sequence:CCGGGCTTCGATGAAGGACGGCAAACTCGAGTTTGCCGTCCTTCATCGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006623.2-1784s21c1
Sequence:CCGGCCCACCCACTGTGATCAATAGCTCGAGCTATTGATCACAGTGGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006623.2-1563s21c1
Sequence:CCGGCAATGCTGCCTACCATGATTGCTCGAGCAATCATGGTAGGCAGCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006623.2-1311s21c1
Sequence:CCGGACGCTAAGCTGCTGGTGAAAGCTCGAGCTTTCACCAGCAGCTTAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006623.2-513s21c1
Sequence:CCGGCTTCGATGAAGGACGGCAAATCTCGAGATTTGCCGTCCTTCATCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006623.2-272s21c1
Sequence:CCGGCAGGACTGTGAAGGCCTTATTCTCGAGAATAAGGCCTTCACAGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006623
VALIDATED
PHGDH MISSION shRNA shRNA Plasmid DNA
phosphoglycerate dehydrogenase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_006623.2-242s1c1
Sequence:CCGGCTTAGCAAAGAGGAGCTGATACTCGAGTATCAGCTCCTCTTTGCTAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006623.3-723s21c1
Sequence:CCGGTCCTTTGGGATGAAGACTATACTCGAGTATAGTCTTCATCCCAAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_006623.2-1200s1c1
Sequence:CCGGAGGTGATAACACAGGGAACATCTCGAGATGTTCCCTGTGTTATCACCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006623.2-454s1c1
Sequence:CCGGCGCAGAACTCACTTGTGGAATCTCGAGATTCCACAAGTGAGTTCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_006623.2-1622s1c1
Sequence:CCGGCAGACTTCACTGGTGTCAGATCTCGAGATCTGACACCAGTGAAGTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_006623.2-512s1c1
Sequence:CCGGGCTTCGATGAAGGACGGCAAACTCGAGTTTGCCGTCCTTCATCGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006623.2-1784s21c1
Sequence:CCGGCCCACCCACTGTGATCAATAGCTCGAGCTATTGATCACAGTGGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006623.2-1563s21c1
Sequence:CCGGCAATGCTGCCTACCATGATTGCTCGAGCAATCATGGTAGGCAGCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006623.2-1311s21c1
Sequence:CCGGACGCTAAGCTGCTGGTGAAAGCTCGAGCTTTCACCAGCAGCTTAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006623.2-513s21c1
Sequence:CCGGCTTCGATGAAGGACGGCAAATCTCGAGATTTGCCGTCCTTCATCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006623.2-272s21c1
Sequence:CCGGCAGGACTGTGAAGGCCTTATTCTCGAGAATAAGGCCTTCACAGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006623
VALIDATED
PHGDH MISSION shRNA Lentiviral Transduction Particles
phosphoglycerate dehydrogenase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_006623.2-242s1c1
Sequence:CCGGCTTAGCAAAGAGGAGCTGATACTCGAGTATCAGCTCCTCTTTGCTAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006623.3-723s21c1
Sequence:CCGGTCCTTTGGGATGAAGACTATACTCGAGTATAGTCTTCATCCCAAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_006623.2-1200s1c1
Sequence:CCGGAGGTGATAACACAGGGAACATCTCGAGATGTTCCCTGTGTTATCACCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006623.2-454s1c1
Sequence:CCGGCGCAGAACTCACTTGTGGAATCTCGAGATTCCACAAGTGAGTTCTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_006623.2-1622s1c1
Sequence:CCGGCAGACTTCACTGGTGTCAGATCTCGAGATCTGACACCAGTGAAGTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_006623.2-512s1c1
Sequence:CCGGGCTTCGATGAAGGACGGCAAACTCGAGTTTGCCGTCCTTCATCGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006623.2-1784s21c1
Sequence:CCGGCCCACCCACTGTGATCAATAGCTCGAGCTATTGATCACAGTGGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006623.2-1563s21c1
Sequence:CCGGCAATGCTGCCTACCATGATTGCTCGAGCAATCATGGTAGGCAGCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006623.2-1311s21c1
Sequence:CCGGACGCTAAGCTGCTGGTGAAAGCTCGAGCTTTCACCAGCAGCTTAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006623.2-513s21c1
Sequence:CCGGCTTCGATGAAGGACGGCAAATCTCGAGATTTGCCGTCCTTCATCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006623.2-272s21c1
Sequence:CCGGCAGGACTGTGAAGGCCTTATTCTCGAGAATAAGGCCTTCACAGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)