EMAIL THIS PAGE TO A FRIEND

PHGR1

proline/histidine/glycine-rich 1

50 Gene Product Result for
UniProtKB ID: C9JFL3
Gene ID:
Mouse(53906) proline/histidine/glycine-rich 1
Rat(499867) proline/histidine/glycine-rich 1
cow(787749) proline/histidine/glycine-rich 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA068787 Anti-PHGR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145644 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001145644 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001145644 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_927939 Rosetta Predictions human pricing
XR_040289 Rosetta Predictions human pricing
XM_001080765 Rosetta Predictions rat pricing
XM_575209 Rosetta Predictions rat pricing
NM_025308 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277573 predicted 314
2 SASI_Hs01_00277574 predicted 395
3 SASI_Hs01_00277575 predicted 317
4 SASI_Hs01_00277576 predicted 330
5 SASI_Hs01_00277577 predicted 363
6 SASI_Hs01_00277578 predicted 283
7 SASI_Hs01_00277579 predicted 359
8 SASI_Hs01_00277580 predicted 355
9 SASI_Hs01_00277581 predicted 380
10 SASI_Hs01_00277582 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517544 predicted 119
2 SASI_Hs02_00517545 predicted 121
3 SASI_Hs02_00517546 predicted 529
4 SASI_Hs02_00517547 predicted 457
5 SASI_Hs02_00517548 predicted 498
6 SASI_Hs02_00517549 predicted 487
7 SASI_Hs02_00517550 predicted 502
8 SASI_Hs02_00517551 predicted 534
9 SASI_Hs02_00517552 predicted 486
10 SASI_Hs02_00517553 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080765 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369252 predicted 283
2 SASI_Rn02_00369253 predicted 315
3 SASI_Rn02_00369254 predicted 95
4 SASI_Rn02_00369255 predicted 273
5 SASI_Rn02_00369256 predicted 320
6 SASI_Rn02_00369257 predicted 104
7 SASI_Rn02_00369258 predicted 19
8 SASI_Rn02_00369259 predicted 102
9 SASI_Rn02_00369260 predicted 174
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403287 predicted 285
2 SASI_Rn02_00403288 predicted 316
3 SASI_Rn02_00403289 predicted 93
4 SASI_Rn02_00403290 predicted 272
5 SASI_Rn02_00403291 predicted 319
6 SASI_Rn02_00403292 predicted 102
7 SASI_Rn02_00403293 predicted 16
8 SASI_Rn02_00403294 predicted 106
9 SASI_Rn02_00403295 predicted 166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191082 predicted 218
2 SASI_Mm01_00191083 predicted 222
3 SASI_Mm01_00191084 predicted 318
4 SASI_Mm01_00191085 predicted 300
5 SASI_Mm01_00191086 predicted 394
6 SASI_Mm01_00191087 predicted 510
7 SASI_Mm01_00191088 predicted 458
8 SASI_Mm01_00191089 predicted 499
9 SASI_Mm01_00191090 predicted 404
10 SASI_Mm01_00191091 predicted 415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145644
PHGR1 MISSION shRNA Bacterial Glycerol Stock
proline/histidine/glycine-rich 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-218s21c1
Sequence:CCGGGGACATGGTGGCCCATCCCATCTCGAGATGGGATGGGCCACCATGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-242s21c1
Sequence:CCGGCATGGCCCAGGGCACTGTCCTCTCGAGAGGACAGTGCCCTGGGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-163s21c1
Sequence:CCGGTGGTCCACACCCTGGCCATGGCTCGAGCCATGGCCAGGGTGTGGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-190s21c1
Sequence:CCGGACACTGTCCTGGAGGACATCACTCGAGTGATGTCCTCCAGGACAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-333s21c1
Sequence:CCGGATCACCCTCCAGGGCATGGTGCTCGAGCACCATGCCCTGGAGGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-127s21c1
Sequence:CCGGACACTGTCATGAGGGACATCACTCGAGTGATGTCCCTCATGACAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-358s21c1
Sequence:CCGGATCCCATGGCCATGGCCCAGGCTCGAGCCTGGGCCATGGCCATGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-116s21c1
Sequence:CCGGCATGGTCCGGGACACTGTCATCTCGAGATGACAGTGTCCCGGACCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-177s21c1
Sequence:CCGGGCCATGGCCCAGGACACTGTCCTCGAGGACAGTGTCCTGGGCCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-206s21c1
Sequence:CCGGCATCACCCTCCAGGACATGGTCTCGAGACCATGTCCTGGAGGGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-253s21c1
Sequence:CCGGGCACTGTCCTGGAGGACATCACTCGAGTGATGTCCTCCAGGACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145644
PHGR1 MISSION shRNA shRNA Plasmid DNA
proline/histidine/glycine-rich 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-218s21c1
Sequence:CCGGGGACATGGTGGCCCATCCCATCTCGAGATGGGATGGGCCACCATGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-242s21c1
Sequence:CCGGCATGGCCCAGGGCACTGTCCTCTCGAGAGGACAGTGCCCTGGGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-163s21c1
Sequence:CCGGTGGTCCACACCCTGGCCATGGCTCGAGCCATGGCCAGGGTGTGGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-190s21c1
Sequence:CCGGACACTGTCCTGGAGGACATCACTCGAGTGATGTCCTCCAGGACAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-333s21c1
Sequence:CCGGATCACCCTCCAGGGCATGGTGCTCGAGCACCATGCCCTGGAGGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-127s21c1
Sequence:CCGGACACTGTCATGAGGGACATCACTCGAGTGATGTCCCTCATGACAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-358s21c1
Sequence:CCGGATCCCATGGCCATGGCCCAGGCTCGAGCCTGGGCCATGGCCATGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-116s21c1
Sequence:CCGGCATGGTCCGGGACACTGTCATCTCGAGATGACAGTGTCCCGGACCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-177s21c1
Sequence:CCGGGCCATGGCCCAGGACACTGTCCTCGAGGACAGTGTCCTGGGCCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-206s21c1
Sequence:CCGGCATCACCCTCCAGGACATGGTCTCGAGACCATGTCCTGGAGGGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-253s21c1
Sequence:CCGGGCACTGTCCTGGAGGACATCACTCGAGTGATGTCCTCCAGGACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145644
PHGR1 MISSION shRNA Lentiviral Transduction Particles
proline/histidine/glycine-rich 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-218s21c1
Sequence:CCGGGGACATGGTGGCCCATCCCATCTCGAGATGGGATGGGCCACCATGTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-242s21c1
Sequence:CCGGCATGGCCCAGGGCACTGTCCTCTCGAGAGGACAGTGCCCTGGGCCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-163s21c1
Sequence:CCGGTGGTCCACACCCTGGCCATGGCTCGAGCCATGGCCAGGGTGTGGACCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-190s21c1
Sequence:CCGGACACTGTCCTGGAGGACATCACTCGAGTGATGTCCTCCAGGACAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-333s21c1
Sequence:CCGGATCACCCTCCAGGGCATGGTGCTCGAGCACCATGCCCTGGAGGGTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-127s21c1
Sequence:CCGGACACTGTCATGAGGGACATCACTCGAGTGATGTCCCTCATGACAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-358s21c1
Sequence:CCGGATCCCATGGCCATGGCCCAGGCTCGAGCCTGGGCCATGGCCATGGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-116s21c1
Sequence:CCGGCATGGTCCGGGACACTGTCATCTCGAGATGACAGTGTCCCGGACCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-177s21c1
Sequence:CCGGGCCATGGCCCAGGACACTGTCCTCGAGGACAGTGTCCTGGGCCATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-206s21c1
Sequence:CCGGCATCACCCTCCAGGACATGGTCTCGAGACCATGTCCTGGAGGGTGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145644.1-253s21c1
Sequence:CCGGGCACTGTCCTGGAGGACATCACTCGAGTGATGTCCTCCAGGACAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)