EMAIL THIS PAGE TO A FRIEND

PHIP

pleckstrin homology domain interacting protein

133 Gene Product Result for
Synonyms: BRWD2 DCAF14 WDR11 ndrp
Gene ID:
Human(55023) Summary: PHIP binds the pleckstrin homology (PH) domain of insulin receptor substrate-1 (IRS1; MIM 147545), modulates insulin signaling, and plays a role in pancreatic beta cell growth and survival (Farhang-Fallah et al., 2000 [PubMed 11018022]
Mouse(83946) pleckstrin homology domain interacting protein
Rat(315843) pleckstrin homology domain interacting protein
Zebrafish(569727) pleckstrin homology domain interacting protein
Horse(100069267) pleckstrin homology domain interacting protein
domestic cat(101100305) pleckstrin homology domain interacting protein
dog(474976) pleckstrin homology domain interacting protein
chicken(421854) pleckstrin homology domain interacting protein
domestic guinea pig(100718997) pleckstrin homology domain interacting protein
naked mole-rat(101722855) pleckstrin homology domain interacting protein
Domestic Rabbit(100357140) pleckstrin homology domain interacting protein
Domestic Rabbit(100359323) pleckstrin homology domain interacting protein
cow(523186) pleckstrin homology domain interacting protein
sheep(101111888) pleckstrin homology domain interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017934 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017934 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017934 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081216 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081216 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081216 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017934 Rosetta Predictions human pricing
NM_001134564 Rosetta Predictions rat pricing
NM_001081216 Rosetta Predictions mouse pricing
XM_358384 Rosetta Predictions mouse pricing
XM_895436 Rosetta Predictions mouse pricing
XM_895482 Rosetta Predictions mouse pricing
XM_895496 Rosetta Predictions mouse pricing
XM_895521 Rosetta Predictions mouse pricing
XM_895539 Rosetta Predictions mouse pricing
XM_994343 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350938 predicted 1882
2 SASI_Hs01_00241882 predicted 4126
3 SASI_Hs01_00241883 predicted 3664
4 SASI_Hs01_00241884 predicted 402
5 SASI_Hs01_00241885 predicted 913
6 SASI_Hs01_00241886 predicted 4661
7 SASI_Hs01_00241887 predicted 3885
8 SASI_Hs01_00241888 predicted 734
9 SASI_Hs01_00241889 predicted 2008
10 SASI_Hs01_00241890 predicted 1225
11 SASI_Hs01_00241881 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134564 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257129 predicted 3551
2 SASI_Rn02_00257130 predicted 3732
3 SASI_Rn02_00257131 predicted 3790
4 SASI_Rn02_00257132 predicted 3319
5 SASI_Rn02_00257133 predicted 4039
6 SASI_Rn02_00257134 predicted 3503
7 SASI_Rn02_00257135 predicted 4645
8 SASI_Rn02_00257136 predicted 2826
9 SASI_Rn02_00257137 predicted 3928
10 SASI_Rn02_00257138 predicted 1686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296321 predicted 3920
2 SASI_Mm02_00296322 predicted 417
3 SASI_Mm02_00296323 predicted 1220
4 SASI_Mm02_00296324 predicted 5707
5 SASI_Mm02_00296325 predicted 3764
6 SASI_Mm02_00296326 predicted 3872
7 SASI_Mm02_00296327 predicted 5743
8 SASI_Mm02_00296328 predicted 5686
9 SASI_Mm02_00296329 predicted 2112
10 SASI_Mm02_00296330 predicted 4101
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_358384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266763 predicted 430
2 SASI_Mm01_00266764 predicted 1880
3 SASI_Mm01_00266765 predicted 1223
4 SASI_Mm01_00266766 predicted 1496
5 SASI_Mm01_00266767 predicted 2202
6 SASI_Mm01_00266768 predicted 1537
7 SASI_Mm01_00266769 predicted 918
8 SASI_Mm01_00266770 predicted 2068
9 SASI_Mm01_00266771 predicted 2112
10 SASI_Mm01_00266772 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226177 predicted 3626
2 SASI_Mm01_00226178 predicted 4653
3 SASI_Mm01_00226179 predicted 3551
4 SASI_Mm01_00226180 predicted 3614
5 SASI_Mm01_00226181 predicted 3031
6 SASI_Mm01_00226182 predicted 4510
7 SASI_Mm01_00226183 predicted 3506
8 SASI_Mm01_00226184 predicted 5378
9 SASI_Mm01_00226185 predicted 4518
10 SASI_Mm01_00226186 predicted 3537
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895482 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277648 predicted 989
2 SASI_Mm01_00277649 predicted 427
3 SASI_Mm01_00277650 predicted 624
4 SASI_Mm01_00277651 predicted 1217
5 SASI_Mm01_00277652 predicted 1500
6 SASI_Mm01_00277653 predicted 1522
7 SASI_Mm01_00277654 predicted 542
8 SASI_Mm01_00277655 predicted 1547
9 SASI_Mm01_00277656 predicted 920
10 SASI_Mm01_00277657 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206576 predicted 427
2 SASI_Mm01_00206577 predicted 1873
3 SASI_Mm01_00206578 predicted 1224
4 SASI_Mm01_00206579 predicted 1494
5 SASI_Mm01_00206580 predicted 2207
6 SASI_Mm01_00206581 predicted 1543
7 SASI_Mm01_00206582 predicted 917
8 SASI_Mm01_00206583 predicted 2062
9 SASI_Mm01_00206584 predicted 2108
10 SASI_Mm01_00206585 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895521 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219347 predicted 1274
2 SASI_Mm01_00219348 predicted 2295
3 SASI_Mm01_00219349 predicted 1194
4 SASI_Mm01_00219350 predicted 1252
5 SASI_Mm01_00219351 predicted 678
6 SASI_Mm01_00219352 predicted 2154
7 SASI_Mm01_00219353 predicted 1142
8 SASI_Mm01_00219354 predicted 3012
9 SASI_Mm01_00219355 predicted 2157
10 SASI_Mm01_00219356 predicted 1175
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895539 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241547 predicted 3002
2 SASI_Mm01_00241548 predicted 4029
3 SASI_Mm01_00241549 predicted 2916
4 SASI_Mm01_00241550 predicted 2979
5 SASI_Mm01_00241551 predicted 2406
6 SASI_Mm01_00241552 predicted 3877
7 SASI_Mm01_00241553 predicted 2866
8 SASI_Mm01_00241554 predicted 4744
9 SASI_Mm01_00241555 predicted 3885
10 SASI_Mm01_00241556 predicted 2906
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237365 predicted 430
2 SASI_Mm01_00237366 predicted 1872
3 SASI_Mm01_00237367 predicted 1223
4 SASI_Mm01_00237368 predicted 1501
5 SASI_Mm01_00237369 predicted 2208
6 SASI_Mm01_00237370 predicted 1540
7 SASI_Mm01_00237371 predicted 912
8 SASI_Mm01_00237372 predicted 2064
9 SASI_Mm01_00237373 predicted 2117
10 SASI_Mm01_00237374 predicted 744
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017934
VALIDATED
PHIP MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain interacting protein
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017934.5-3353s21c1
Sequence:CCGGCATGATATGCCTGACGTTATACTCGAGTATAACGTCAGGCATATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017934.5-5923s21c1
Sequence:CCGGTATTGCCCTTAGATAGGTTATCTCGAGATAACCTATCTAAGGGCAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017934.5-3584s21c1
Sequence:CCGGATGGAGCTTATACCTAATAATCTCGAGATTATTAGGTATAAGCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017934.5-1390s21c1
Sequence:CCGGAGCACGTATTTGGCAATTTAACTCGAGTTAAATTGCCAAATACGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017934.5-3910s21c1
Sequence:CCGGTCGATATATAGAGCATAATACCTCGAGGTATTATGCTCTATATATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017934.5-802s21c1
Sequence:CCGGTCGAACTGGCAGACGGATATTCTCGAGAATATCCGTCTGCCAGTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017934.5-6037s21c1
Sequence:CCGGCACTCTTTAGGAGCATAATATCTCGAGATATTATGCTCCTAAAGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017934.5-1250s21c1
Sequence:CCGGGATCATATTATTCGGGTTTATCTCGAGATAAACCCGAATAATATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017934.4-518s1c1
Sequence:CCGGGACAGTCTTTACTACGCACAACTCGAGTTGTGCGTAGTAAAGACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017934.4-706s1c1
Sequence:CCGGGCAGTGTATCAGCACATGAAACTCGAGTTTCATGTGCTGATACACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017934.4-793s1c1
Sequence:CCGGCGGATATTTACTGGTTCTGATCTCGAGATCAGAACCAGTAAATATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017934.4-5059s1c1
Sequence:CCGGCCAGGAACCATTCAAGTAAATCTCGAGATTTACTTGAATGGTTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017934.4-3330s1c1
Sequence:CCGGCCATGATATGCCTGACGTTATCTCGAGATAACGTCAGGCATATCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017934.4-5415s1c1
Sequence:CCGGGTTAAGGAGAAGTAACCGAAACTCGAGTTTCGGTTACTTCTCCTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017934.4-511s1c1
Sequence:CCGGGCTGGAAGACAGTCTTTACTACTCGAGTAGTAAAGACTGTCTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017934
VALIDATED
PHIP MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain interacting protein
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017934.5-3353s21c1
Sequence:CCGGCATGATATGCCTGACGTTATACTCGAGTATAACGTCAGGCATATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017934.5-5923s21c1
Sequence:CCGGTATTGCCCTTAGATAGGTTATCTCGAGATAACCTATCTAAGGGCAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017934.5-3584s21c1
Sequence:CCGGATGGAGCTTATACCTAATAATCTCGAGATTATTAGGTATAAGCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017934.5-1390s21c1
Sequence:CCGGAGCACGTATTTGGCAATTTAACTCGAGTTAAATTGCCAAATACGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017934.5-3910s21c1
Sequence:CCGGTCGATATATAGAGCATAATACCTCGAGGTATTATGCTCTATATATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017934.5-802s21c1
Sequence:CCGGTCGAACTGGCAGACGGATATTCTCGAGAATATCCGTCTGCCAGTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017934.5-6037s21c1
Sequence:CCGGCACTCTTTAGGAGCATAATATCTCGAGATATTATGCTCCTAAAGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017934.5-1250s21c1
Sequence:CCGGGATCATATTATTCGGGTTTATCTCGAGATAAACCCGAATAATATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017934.4-518s1c1
Sequence:CCGGGACAGTCTTTACTACGCACAACTCGAGTTGTGCGTAGTAAAGACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017934.4-706s1c1
Sequence:CCGGGCAGTGTATCAGCACATGAAACTCGAGTTTCATGTGCTGATACACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017934.4-793s1c1
Sequence:CCGGCGGATATTTACTGGTTCTGATCTCGAGATCAGAACCAGTAAATATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017934.4-5059s1c1
Sequence:CCGGCCAGGAACCATTCAAGTAAATCTCGAGATTTACTTGAATGGTTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017934.4-3330s1c1
Sequence:CCGGCCATGATATGCCTGACGTTATCTCGAGATAACGTCAGGCATATCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017934.4-5415s1c1
Sequence:CCGGGTTAAGGAGAAGTAACCGAAACTCGAGTTTCGGTTACTTCTCCTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017934.4-511s1c1
Sequence:CCGGGCTGGAAGACAGTCTTTACTACTCGAGTAGTAAAGACTGTCTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017934
VALIDATED
PHIP MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain interacting protein
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017934.5-3353s21c1
Sequence:CCGGCATGATATGCCTGACGTTATACTCGAGTATAACGTCAGGCATATCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017934.5-5923s21c1
Sequence:CCGGTATTGCCCTTAGATAGGTTATCTCGAGATAACCTATCTAAGGGCAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017934.5-3584s21c1
Sequence:CCGGATGGAGCTTATACCTAATAATCTCGAGATTATTAGGTATAAGCTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017934.5-1390s21c1
Sequence:CCGGAGCACGTATTTGGCAATTTAACTCGAGTTAAATTGCCAAATACGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017934.5-3910s21c1
Sequence:CCGGTCGATATATAGAGCATAATACCTCGAGGTATTATGCTCTATATATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017934.5-802s21c1
Sequence:CCGGTCGAACTGGCAGACGGATATTCTCGAGAATATCCGTCTGCCAGTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017934.5-6037s21c1
Sequence:CCGGCACTCTTTAGGAGCATAATATCTCGAGATATTATGCTCCTAAAGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017934.5-1250s21c1
Sequence:CCGGGATCATATTATTCGGGTTTATCTCGAGATAAACCCGAATAATATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017934.4-518s1c1
Sequence:CCGGGACAGTCTTTACTACGCACAACTCGAGTTGTGCGTAGTAAAGACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017934.4-706s1c1
Sequence:CCGGGCAGTGTATCAGCACATGAAACTCGAGTTTCATGTGCTGATACACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017934.4-793s1c1
Sequence:CCGGCGGATATTTACTGGTTCTGATCTCGAGATCAGAACCAGTAAATATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017934.4-5059s1c1
Sequence:CCGGCCAGGAACCATTCAAGTAAATCTCGAGATTTACTTGAATGGTTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017934.4-3330s1c1
Sequence:CCGGCCATGATATGCCTGACGTTATCTCGAGATAACGTCAGGCATATCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017934.4-5415s1c1
Sequence:CCGGGTTAAGGAGAAGTAACCGAAACTCGAGTTTCGGTTACTTCTCCTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017934.4-511s1c1
Sequence:CCGGGCTGGAAGACAGTCTTTACTACTCGAGTAGTAAAGACTGTCTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081216
VALIDATED
PHIP MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology domain interacting protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081216.1-1693s21c1
Sequence:CCGGGGAGTCAAAGTTCGATCTTATCTCGAGATAAGATCGAACTTTGACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081216.1-9673s21c1
Sequence:CCGGGTAGATTATCTGAGCTATAAACTCGAGTTTATAGCTCAGATAATCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081216.1-3623s21c1
Sequence:CCGGTTGAATGTAGGTCGCTAATTTCTCGAGAAATTAGCGACCTACATTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081216.1-774s21c1
Sequence:CCGGTCGAACTGGCAGGCGGATATTCTCGAGAATATCCGCCTGCCAGTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081216.1-1352s21c1
Sequence:CCGGGTGATGGGACAGCACGAATTTCTCGAGAAATTCGTGCTGTCCCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081216
VALIDATED
PHIP MISSION shRNA shRNA Plasmid DNA
pleckstrin homology domain interacting protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081216.1-1693s21c1
Sequence:CCGGGGAGTCAAAGTTCGATCTTATCTCGAGATAAGATCGAACTTTGACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081216.1-9673s21c1
Sequence:CCGGGTAGATTATCTGAGCTATAAACTCGAGTTTATAGCTCAGATAATCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081216.1-3623s21c1
Sequence:CCGGTTGAATGTAGGTCGCTAATTTCTCGAGAAATTAGCGACCTACATTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081216.1-774s21c1
Sequence:CCGGTCGAACTGGCAGGCGGATATTCTCGAGAATATCCGCCTGCCAGTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081216.1-1352s21c1
Sequence:CCGGGTGATGGGACAGCACGAATTTCTCGAGAAATTCGTGCTGTCCCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081216
VALIDATED
PHIP MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology domain interacting protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081216.1-1693s21c1
Sequence:CCGGGGAGTCAAAGTTCGATCTTATCTCGAGATAAGATCGAACTTTGACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081216.1-9673s21c1
Sequence:CCGGGTAGATTATCTGAGCTATAAACTCGAGTTTATAGCTCAGATAATCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081216.1-3623s21c1
Sequence:CCGGTTGAATGTAGGTCGCTAATTTCTCGAGAAATTAGCGACCTACATTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081216.1-774s21c1
Sequence:CCGGTCGAACTGGCAGGCGGATATTCTCGAGAATATCCGCCTGCCAGTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081216.1-1352s21c1
Sequence:CCGGGTGATGGGACAGCACGAATTTCTCGAGAAATTCGTGCTGTCCCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)