EMAIL THIS PAGE TO A FRIEND

PHKA2

phosphorylase kinase, alpha 2 (liver)

106 Gene Product Result for
Synonyms: GSD9A PHK PYK PYKL XLG XLG2
UniProtKB ID: P46019, A8K1T1, Q6LAJ5, Q7Z6W0, Q96CR3, Q9UDA1
Gene ID:
Human(5256) Summary: Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, and the hepatic isoform is encoded by this gene. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, which are encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9A, also known as X-linked liver glycogenosis. Alternatively spliced transcript variants have been reported, but the full-length nature of these variants has not been determined.[provided by RefSeq, Feb 2010]
Mouse(110094) phosphorylase kinase alpha 2
Rat(678739) phosphorylase kinase, alpha 2
chicken(418612) phosphorylase kinase, alpha 2 (liver)
Horse(100051530) phosphorylase kinase, alpha 2 (liver)
domestic cat(101100185) phosphorylase kinase, alpha 2 (liver)
dog(480857) phosphorylase kinase, alpha 2 (liver)
domestic guinea pig(100719858) phosphorylase kinase, alpha 2 (liver)
naked mole-rat(101713572) phosphorylase kinase, alpha 2 (liver)
Domestic Rabbit(100190898) phosphorylase kinase, alpha 2 (liver)
cow(515732) phosphorylase kinase, alpha 2 (liver)
sheep(101108807) phosphorylase kinase, alpha 2 (liver)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000292 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000292 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000292 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000292 Rosetta Predictions human pricing
XM_001053211 Rosetta Predictions rat pricing
XM_001053345 Rosetta Predictions rat pricing
XM_001053419 Rosetta Predictions rat pricing
XM_001053483 Rosetta Predictions rat pricing
XM_001053550 Rosetta Predictions rat pricing
NM_172783 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302261 predicted 1689
2 SASI_Hs01_00153043 predicted 2701
3 SASI_Hs01_00153044 predicted 2294
4 SASI_Hs01_00153045 predicted 2253
5 SASI_Hs01_00153046 predicted 3110
6 SASI_Hs01_00153047 predicted 4107
7 SASI_Hs01_00153048 predicted 2608
8 SASI_Hs01_00153051 predicted 943
9 SASI_Hs02_00302262 predicted 1345
10 SASI_Hs02_00302263 predicted 2444
11 SASI_Hs01_00153049 predicted 663
12 SASI_Hs01_00153050 predicted 2050
13 SASI_Hs01_00153052 predicted 1629
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271642 predicted 426
2 SASI_Rn02_00271643 predicted 325
3 SASI_Rn02_00271644 predicted 492
4 SASI_Rn02_00271645 predicted 334
5 SASI_Rn02_00271646 predicted 421
6 SASI_Rn02_00271647 predicted 336
7 SASI_Rn02_00271648 predicted 465
8 SASI_Rn02_00271649 predicted 419
9 SASI_Rn02_00271650 predicted 486
10 SASI_Rn02_00271651 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272027 predicted 643
2 SASI_Rn02_00272028 predicted 456
3 SASI_Rn02_00272029 predicted 297
4 SASI_Rn02_00272030 predicted 296
5 SASI_Rn02_00272031 predicted 686
6 SASI_Rn02_00272032 predicted 694
7 SASI_Rn02_00272033 predicted 379
8 SASI_Rn02_00272034 predicted 678
9 SASI_Rn02_00272035 predicted 597
10 SASI_Rn02_00272036 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272259 predicted 1874
2 SASI_Rn02_00272260 predicted 1939
3 SASI_Rn02_00272261 predicted 2846
4 SASI_Rn02_00272262 predicted 3086
5 SASI_Rn02_00272263 predicted 1822
6 SASI_Rn02_00272264 predicted 918
7 SASI_Rn02_00272265 predicted 931
8 SASI_Rn02_00272266 predicted 1363
9 SASI_Rn02_00272267 predicted 837
10 SASI_Rn02_00272268 predicted 2385
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053483 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272493 predicted 386
2 SASI_Rn02_00272494 predicted 285
3 SASI_Rn02_00272495 predicted 461
4 SASI_Rn02_00272496 predicted 299
5 SASI_Rn02_00272497 predicted 380
6 SASI_Rn02_00272498 predicted 294
7 SASI_Rn02_00272499 predicted 417
8 SASI_Rn02_00272500 predicted 386
9 SASI_Rn02_00272501 predicted 449
10 SASI_Rn02_00272502 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053550 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272724 predicted 4156
2 SASI_Rn02_00272725 predicted 4251
3 SASI_Rn02_00272726 predicted 4250
4 SASI_Rn02_00272727 predicted 4199
5 SASI_Rn02_00272728 predicted 4235
6 SASI_Rn02_00272729 predicted 4254
7 SASI_Rn02_00272730 predicted 4149
8 SASI_Rn02_00272731 predicted 4249
9 SASI_Rn02_00272732 predicted 4243
10 SASI_Rn02_00272733 predicted 4230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160577 predicted 2313
2 SASI_Mm01_00160578 predicted 2413
3 SASI_Mm01_00160579 predicted 697
4 SASI_Mm01_00160580 predicted 262
5 SASI_Mm01_00160582 predicted 2579
6 SASI_Mm01_00160583 predicted 1671
7 SASI_Mm01_00160584 predicted 2812
8 SASI_Mm01_00160586 predicted 2575
9 SASI_Mm02_00344678 predicted 3047
10 SASI_Mm02_00344679 predicted 1524
11 SASI_Mm01_00160581 predicted 1401
12 SASI_Mm01_00160585 predicted 2142
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000292
VALIDATED
PHKA2 MISSION shRNA Bacterial Glycerol Stock
phosphorylase kinase, alpha 2 (liver)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_000292.1-4405s1c1
Sequence:CCGGGCTGCCTTGATGTAACATAATCTCGAGATTATGTTACATCAAGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_000292.1-1252s1c1
Sequence:CCGGCCGCCTAACAAGGTAGATGAACTCGAGTTCATCTACCTTGTTAGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000292.1-649s1c1
Sequence:CCGGGCATATAAAGTCGCTGATTATCTCGAGATAATCAGCGACTTTATATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_000292.1-2269s1c1
Sequence:CCGGCCCATGACTTTGCCGACTAAACTCGAGTTTAGTCGGCAAAGTCATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000292.1-3842s1c1
Sequence:CCGGCCTGGAAACATGATCACACTCCTCGAGGAGTGTGATCATGTTTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000292.1-3784s1c1
Sequence:CCGGGCTTCTTATTTGCAGGAATTGCTCGAGCAATTCCTGCAAATAAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_000292.1-895s1c1
Sequence:CCGGGCTGGACTTCTTTCCATTATTCTCGAGAATAATGGAAAGAAGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000292.1-1522s1c1
Sequence:CCGGGCGGACATTCATCCAATTCAACTCGAGTTGAATTGGATGAATGTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000292.1-1638s1c1
Sequence:CCGGCCTTGGAACCTCTAAACTATACTCGAGTATAGTTTAGAGGTTCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000292.1-4156s1c1
Sequence:CCGGGAACTGAGACGCCAGCTTAAACTCGAGTTTAAGCTGGCGTCTCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_000292.1-2047s1c1
Sequence:CCGGGATTCAGATTTGGTAGGATATCTCGAGATATCCTACCAAATCTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000292
VALIDATED
PHKA2 MISSION shRNA shRNA Plasmid DNA
phosphorylase kinase, alpha 2 (liver)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_000292.1-4405s1c1
Sequence:CCGGGCTGCCTTGATGTAACATAATCTCGAGATTATGTTACATCAAGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_000292.1-1252s1c1
Sequence:CCGGCCGCCTAACAAGGTAGATGAACTCGAGTTCATCTACCTTGTTAGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000292.1-649s1c1
Sequence:CCGGGCATATAAAGTCGCTGATTATCTCGAGATAATCAGCGACTTTATATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_000292.1-2269s1c1
Sequence:CCGGCCCATGACTTTGCCGACTAAACTCGAGTTTAGTCGGCAAAGTCATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000292.1-3842s1c1
Sequence:CCGGCCTGGAAACATGATCACACTCCTCGAGGAGTGTGATCATGTTTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000292.1-3784s1c1
Sequence:CCGGGCTTCTTATTTGCAGGAATTGCTCGAGCAATTCCTGCAAATAAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_000292.1-895s1c1
Sequence:CCGGGCTGGACTTCTTTCCATTATTCTCGAGAATAATGGAAAGAAGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000292.1-1522s1c1
Sequence:CCGGGCGGACATTCATCCAATTCAACTCGAGTTGAATTGGATGAATGTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000292.1-1638s1c1
Sequence:CCGGCCTTGGAACCTCTAAACTATACTCGAGTATAGTTTAGAGGTTCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000292.1-4156s1c1
Sequence:CCGGGAACTGAGACGCCAGCTTAAACTCGAGTTTAAGCTGGCGTCTCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_000292.1-2047s1c1
Sequence:CCGGGATTCAGATTTGGTAGGATATCTCGAGATATCCTACCAAATCTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000292
VALIDATED
PHKA2 MISSION shRNA Lentiviral Transduction Particles
phosphorylase kinase, alpha 2 (liver)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_000292.1-4405s1c1
Sequence:CCGGGCTGCCTTGATGTAACATAATCTCGAGATTATGTTACATCAAGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_000292.1-1252s1c1
Sequence:CCGGCCGCCTAACAAGGTAGATGAACTCGAGTTCATCTACCTTGTTAGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000292.1-649s1c1
Sequence:CCGGGCATATAAAGTCGCTGATTATCTCGAGATAATCAGCGACTTTATATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_000292.1-2269s1c1
Sequence:CCGGCCCATGACTTTGCCGACTAAACTCGAGTTTAGTCGGCAAAGTCATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000292.1-3842s1c1
Sequence:CCGGCCTGGAAACATGATCACACTCCTCGAGGAGTGTGATCATGTTTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000292.1-3784s1c1
Sequence:CCGGGCTTCTTATTTGCAGGAATTGCTCGAGCAATTCCTGCAAATAAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_000292.1-895s1c1
Sequence:CCGGGCTGGACTTCTTTCCATTATTCTCGAGAATAATGGAAAGAAGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000292.1-1522s1c1
Sequence:CCGGGCGGACATTCATCCAATTCAACTCGAGTTGAATTGGATGAATGTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000292.1-1638s1c1
Sequence:CCGGCCTTGGAACCTCTAAACTATACTCGAGTATAGTTTAGAGGTTCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000292.1-4156s1c1
Sequence:CCGGGAACTGAGACGCCAGCTTAAACTCGAGTTTAAGCTGGCGTCTCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_000292.1-2047s1c1
Sequence:CCGGGATTCAGATTTGGTAGGATATCTCGAGATATCCTACCAAATCTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172783
VALIDATED
PHKA2 MISSION shRNA Bacterial Glycerol Stock
phosphorylase kinase, alpha 2 (liver)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172783.2-1586s21c1
Sequence:CCGGTGCCAAACTTGGACGAAATAACTCGAGTTATTTCGTCCAAGTTTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172783.1-2132s1c1
Sequence:CCGGGCCACCTTCTTCAAAGCACATCTCGAGATGTGCTTTGAAGAAGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172783.1-271s1c1
Sequence:CCGGCGGGACAATATCTATAGCATACTCGAGTATGCTATAGATATTGTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172783.1-2505s1c1
Sequence:CCGGCCGCTGGGATACCAATTTGTTCTCGAGAACAAATTGGTATCCCAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172783.1-907s1c1
Sequence:CCGGGCTGGACTTCTTTCTATTATTCTCGAGAATAATAGAAAGAAGTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172783.2-2751s21c1
Sequence:CCGGGAGCTCACAGAACTCATATATCTCGAGATATATGAGTTCTGTGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172783.2-1073s21c1
Sequence:CCGGTTATGACCCTGCCGAACTTAACTCGAGTTAAGTTCGGCAGGGTCATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172783.2-906s21c1
Sequence:CCGGGCTGGACTTCTTTCTATTATTCTCGAGAATAATAGAAAGAAGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172783.2-4052s21c1
Sequence:CCGGAGAAGCACCCTGGGATCATTTCTCGAGAAATGATCCCAGGGTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172783
VALIDATED
PHKA2 MISSION shRNA shRNA Plasmid DNA
phosphorylase kinase, alpha 2 (liver)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172783.2-1586s21c1
Sequence:CCGGTGCCAAACTTGGACGAAATAACTCGAGTTATTTCGTCCAAGTTTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172783.1-2132s1c1
Sequence:CCGGGCCACCTTCTTCAAAGCACATCTCGAGATGTGCTTTGAAGAAGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172783.1-271s1c1
Sequence:CCGGCGGGACAATATCTATAGCATACTCGAGTATGCTATAGATATTGTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172783.1-2505s1c1
Sequence:CCGGCCGCTGGGATACCAATTTGTTCTCGAGAACAAATTGGTATCCCAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172783.1-907s1c1
Sequence:CCGGGCTGGACTTCTTTCTATTATTCTCGAGAATAATAGAAAGAAGTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172783.2-2751s21c1
Sequence:CCGGGAGCTCACAGAACTCATATATCTCGAGATATATGAGTTCTGTGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172783.2-1073s21c1
Sequence:CCGGTTATGACCCTGCCGAACTTAACTCGAGTTAAGTTCGGCAGGGTCATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172783.2-906s21c1
Sequence:CCGGGCTGGACTTCTTTCTATTATTCTCGAGAATAATAGAAAGAAGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172783.2-4052s21c1
Sequence:CCGGAGAAGCACCCTGGGATCATTTCTCGAGAAATGATCCCAGGGTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172783
VALIDATED
PHKA2 MISSION shRNA Lentiviral Transduction Particles
phosphorylase kinase, alpha 2 (liver)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172783.2-1586s21c1
Sequence:CCGGTGCCAAACTTGGACGAAATAACTCGAGTTATTTCGTCCAAGTTTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172783.1-2132s1c1
Sequence:CCGGGCCACCTTCTTCAAAGCACATCTCGAGATGTGCTTTGAAGAAGGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172783.1-271s1c1
Sequence:CCGGCGGGACAATATCTATAGCATACTCGAGTATGCTATAGATATTGTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172783.1-2505s1c1
Sequence:CCGGCCGCTGGGATACCAATTTGTTCTCGAGAACAAATTGGTATCCCAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172783.1-907s1c1
Sequence:CCGGGCTGGACTTCTTTCTATTATTCTCGAGAATAATAGAAAGAAGTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172783.2-2751s21c1
Sequence:CCGGGAGCTCACAGAACTCATATATCTCGAGATATATGAGTTCTGTGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172783.2-1073s21c1
Sequence:CCGGTTATGACCCTGCCGAACTTAACTCGAGTTAAGTTCGGCAGGGTCATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172783.2-906s21c1
Sequence:CCGGGCTGGACTTCTTTCTATTATTCTCGAGAATAATAGAAAGAAGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172783.2-4052s21c1
Sequence:CCGGAGAAGCACCCTGGGATCATTTCTCGAGAAATGATCCCAGGGTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)