EMAIL THIS PAGE TO A FRIEND

PHKB

phosphorylase kinase, beta

103 Gene Product Result for
UniProtKB ID: Q93100, Q8N4T5
Gene ID:
Human(5257) Summary: Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, encoded by this gene, which is a member of the phosphorylase b kinase regulatory subunit family. The gamma subunit also includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9B, also known as phosphorylase kinase deficiency of liver and muscle. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. Two pseudogenes have been found on chromosomes 14 and 20, respectively.[provided by RefSeq, Feb 2010]
Mouse(102093) phosphorylase kinase beta
Rat(361377) phosphorylase kinase, beta
Zebrafish(569706) phosphorylase kinase, beta
Horse(100050040) phosphorylase kinase, beta
domestic cat(101088635) phosphorylase kinase, beta
dog(478139) phosphorylase kinase, beta
chicken(415741) phosphorylase kinase, beta
cow(511783) phosphorylase kinase, beta
sheep(101110353) phosphorylase kinase, beta
Domestic Rabbit(100009137) phosphorylase kinase, beta
naked mole-rat(101706280) phosphorylase kinase, beta
domestic guinea pig(100724099) phosphorylase kinase, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199446 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199446 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199446 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000293 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000293 Rosetta Predictions human pricing
NM_001031835 Rosetta Predictions human pricing
NM_001014152 Rosetta Predictions rat pricing
NM_199446 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222414 predicted 2826
2 SASI_Hs01_00222415 predicted 754
3 SASI_Hs01_00222417 predicted 1659
4 SASI_Hs01_00222419 predicted 886
5 SASI_Hs02_00302264 predicted 482
6 SASI_Hs01_00222420 predicted 1788
7 SASI_Hs01_00222421 predicted 3340
8 SASI_Hs01_00222422 predicted 1479
9 SASI_Hs02_00302265 predicted 2940
10 SASI_Hs02_00302266 predicted 1379
11 SASI_Hs01_00222413 predicted 1091
12 SASI_Hs01_00222416 predicted 969
13 SASI_Hs01_00222418 predicted 3339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181843 predicted 2938
2 SASI_Hs01_00181844 predicted 857
3 SASI_Hs01_00181846 predicted 1768
4 SASI_Hs01_00181848 predicted 1005
5 SASI_Hs02_00307834 predicted 587
6 SASI_Hs01_00181849 predicted 1907
7 SASI_Hs01_00181850 predicted 3447
8 SASI_Hs01_00181851 predicted 1589
9 SASI_Hs02_00307835 predicted 3056
10 SASI_Hs02_00307836 predicted 1494
11 SASI_Hs01_00181842 predicted 1216
12 SASI_Hs01_00181845 predicted 1097
13 SASI_Hs01_00181847 predicted 3452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105377 predicted 752
2 SASI_Rn01_00105378 predicted 1812
3 SASI_Rn01_00105381 predicted 2489
4 SASI_Rn02_00201636 predicted 1956
5 SASI_Rn01_00105382 predicted 2866
6 SASI_Rn01_00105383 predicted 1443
7 SASI_Rn01_00105384 predicted 2912
8 SASI_Rn01_00105385 predicted 1221
9 SASI_Rn01_00105386 predicted 1943
10 SASI_Rn02_00201637 predicted 1080
11 SASI_Rn01_00105379 predicted 1982
12 SASI_Rn01_00105380 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199446 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176117 predicted 2420
2 SASI_Mm01_00176118 predicted 2073
3 SASI_Mm01_00176119 predicted 2388
4 SASI_Mm02_00351463 predicted 2920
5 SASI_Mm01_00176121 predicted 2023
6 SASI_Mm01_00176122 predicted 876
7 SASI_Mm01_00176123 predicted 3487
8 SASI_Mm01_00176124 predicted 1197
9 SASI_Mm01_00176125 predicted 2622
10 SASI_Mm02_00351464 predicted 1855
11 SASI_Mm01_00176120 predicted 2094
12 SASI_Mm01_00176126 predicted 1831
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199446
VALIDATED
PHKB MISSION shRNA Bacterial Glycerol Stock
phosphorylase kinase, beta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199446.1-1936s21c1
Sequence:CCGGGCACTACAGTTCATTAAGCAACTCGAGTTGCTTAATGAACTGTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199446.1-3108s1c1
Sequence:CCGGCCAGCCAAAGTATAGACAGATCTCGAGATCTGTCTATACTTTGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199446.1-2986s21c1
Sequence:CCGGCGCACACCTAATGGTATCGTTCTCGAGAACGATACCATTAGGTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199446.1-532s21c1
Sequence:CCGGGCTGATAAGGTCCAACAGTTTCTCGAGAAACTGTTGGACCTTATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199446.1-2986s1c1
Sequence:CCGGCGCACACCTAATGGTATCGTTCTCGAGAACGATACCATTAGGTGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199446.1-532s1c1
Sequence:CCGGGCTGATAAGGTCCAACAGTTTCTCGAGAAACTGTTGGACCTTATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199446.1-1936s1c1
Sequence:CCGGGCACTACAGTTCATTAAGCAACTCGAGTTGCTTAATGAACTGTAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199446.1-3108s21c1
Sequence:CCGGCCAGCCAAAGTATAGACAGATCTCGAGATCTGTCTATACTTTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199446.1-974s21c1
Sequence:CCGGGCTCACTGTTACCCAGAGAATCTCGAGATTCTCTGGGTAACAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199446.1-974s1c1
Sequence:CCGGGCTCACTGTTACCCAGAGAATCTCGAGATTCTCTGGGTAACAGTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199446
VALIDATED
PHKB MISSION shRNA shRNA Plasmid DNA
phosphorylase kinase, beta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199446.1-1936s21c1
Sequence:CCGGGCACTACAGTTCATTAAGCAACTCGAGTTGCTTAATGAACTGTAGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199446.1-3108s1c1
Sequence:CCGGCCAGCCAAAGTATAGACAGATCTCGAGATCTGTCTATACTTTGGCTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000345016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199446.1-2986s21c1
Sequence:CCGGCGCACACCTAATGGTATCGTTCTCGAGAACGATACCATTAGGTGTGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000345013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199446.1-532s21c1
Sequence:CCGGGCTGATAAGGTCCAACAGTTTCTCGAGAAACTGTTGGACCTTATCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199446.1-2986s1c1
Sequence:CCGGCGCACACCTAATGGTATCGTTCTCGAGAACGATACCATTAGGTGTGCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199446.1-532s1c1
Sequence:CCGGGCTGATAAGGTCCAACAGTTTCTCGAGAAACTGTTGGACCTTATCAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199446.1-1936s1c1
Sequence:CCGGGCACTACAGTTCATTAAGCAACTCGAGTTGCTTAATGAACTGTAGTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000345017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199446.1-3108s21c1
Sequence:CCGGCCAGCCAAAGTATAGACAGATCTCGAGATCTGTCTATACTTTGGCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000345014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199446.1-974s21c1
Sequence:CCGGGCTCACTGTTACCCAGAGAATCTCGAGATTCTCTGGGTAACAGTGAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000025079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199446.1-974s1c1
Sequence:CCGGGCTCACTGTTACCCAGAGAATCTCGAGATTCTCTGGGTAACAGTGAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199446
VALIDATED
PHKB MISSION shRNA Lentiviral Transduction Particles
phosphorylase kinase, beta
Mouse
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000345015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199446.1-1936s21c1
Sequence:CCGGGCACTACAGTTCATTAAGCAACTCGAGTTGCTTAATGAACTGTAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199446.1-3108s1c1
Sequence:CCGGCCAGCCAAAGTATAGACAGATCTCGAGATCTGTCTATACTTTGGCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199446.1-2986s21c1
Sequence:CCGGCGCACACCTAATGGTATCGTTCTCGAGAACGATACCATTAGGTGTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199446.1-532s21c1
Sequence:CCGGGCTGATAAGGTCCAACAGTTTCTCGAGAAACTGTTGGACCTTATCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199446.1-2986s1c1
Sequence:CCGGCGCACACCTAATGGTATCGTTCTCGAGAACGATACCATTAGGTGTGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199446.1-532s1c1
Sequence:CCGGGCTGATAAGGTCCAACAGTTTCTCGAGAAACTGTTGGACCTTATCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199446.1-1936s1c1
Sequence:CCGGGCACTACAGTTCATTAAGCAACTCGAGTTGCTTAATGAACTGTAGTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199446.1-3108s21c1
Sequence:CCGGCCAGCCAAAGTATAGACAGATCTCGAGATCTGTCTATACTTTGGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199446.1-974s21c1
Sequence:CCGGGCTCACTGTTACCCAGAGAATCTCGAGATTCTCTGGGTAACAGTGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199446.1-974s1c1
Sequence:CCGGGCTCACTGTTACCCAGAGAATCTCGAGATTCTCTGGGTAACAGTGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000293
VALIDATED
PHKB MISSION shRNA Bacterial Glycerol Stock
phosphorylase kinase, beta
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000293.1-3722s1c1
Sequence:CCGGGAACTTCTCTTAGTGGTATTGCTCGAGCAATACCACTAAGAGAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-3101s1c1
Sequence:CCGGGACTGGTCAAAGAAGCATTTACTCGAGTAAATGCTTCTTTGACCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-3371s1c1
Sequence:CCGGGCTTAATCAAGGCAGCCATTACTCGAGTAATGGCTGCCTTGATTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-3455s1c1
Sequence:CCGGGCATGTCATAGCCAATCTAACCTCGAGGTTAGATTGGCTATGACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000293.1-2928s1c1
Sequence:CCGGCCTGTCAGATATGACCATGTACTCGAGTACATGGTCATATCTGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000293.1-1079s1c1
Sequence:CCGGCAGCTGAAATTAAGCTATTTGCTCGAGCAAATAGCTTAATTTCAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-3382s1c1
Sequence:CCGGGCAGCCATTAATATACGAACTCTCGAGAGTTCGTATATTAATGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-3514s1c1
Sequence:CCGGCTCATGATTATGCCAACTATACTCGAGTATAGTTGGCATAATCATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-3585s1c1
Sequence:CCGGCGCTGCATGTTGTATGATCAACTCGAGTTGATCATACAACATGCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-2281s1c1
Sequence:CCGGCCCAACTTCATCACAAAGGAACTCGAGTTCCTTTGTGATGAAGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-101s1c1
Sequence:CCGGGCTCAGTTTATGAACCTCTTACTCGAGTAAGAGGTTCATAAACTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-875s1c1
Sequence:CCGGCCAGAGAATCAAGATCACATACTCGAGTATGTGATCTTGATTCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000293
VALIDATED
PHKB MISSION shRNA shRNA Plasmid DNA
phosphorylase kinase, beta
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000293.1-3722s1c1
Sequence:CCGGGAACTTCTCTTAGTGGTATTGCTCGAGCAATACCACTAAGAGAAGTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-3101s1c1
Sequence:CCGGGACTGGTCAAAGAAGCATTTACTCGAGTAAATGCTTCTTTGACCAGTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-3371s1c1
Sequence:CCGGGCTTAATCAAGGCAGCCATTACTCGAGTAATGGCTGCCTTGATTAAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000197195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-3455s1c1
Sequence:CCGGGCATGTCATAGCCAATCTAACCTCGAGGTTAGATTGGCTATGACATGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000006199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000293.1-2928s1c1
Sequence:CCGGCCTGTCAGATATGACCATGTACTCGAGTACATGGTCATATCTGACAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000194723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000293.1-1079s1c1
Sequence:CCGGCAGCTGAAATTAAGCTATTTGCTCGAGCAAATAGCTTAATTTCAGCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-3382s1c1
Sequence:CCGGGCAGCCATTAATATACGAACTCTCGAGAGTTCGTATATTAATGGCTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-3514s1c1
Sequence:CCGGCTCATGATTATGCCAACTATACTCGAGTATAGTTGGCATAATCATGAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000006196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-3585s1c1
Sequence:CCGGCGCTGCATGTTGTATGATCAACTCGAGTTGATCATACAACATGCAGCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000006200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-2281s1c1
Sequence:CCGGCCCAACTTCATCACAAAGGAACTCGAGTTCCTTTGTGATGAAGTTGGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000006197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-101s1c1
Sequence:CCGGGCTCAGTTTATGAACCTCTTACTCGAGTAAGAGGTTCATAAACTGAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000006198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-875s1c1
Sequence:CCGGCCAGAGAATCAAGATCACATACTCGAGTATGTGATCTTGATTCTCTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000293
VALIDATED
PHKB MISSION shRNA Lentiviral Transduction Particles
phosphorylase kinase, beta
Human
12 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000196867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000293.1-3722s1c1
Sequence:CCGGGAACTTCTCTTAGTGGTATTGCTCGAGCAATACCACTAAGAGAAGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-3101s1c1
Sequence:CCGGGACTGGTCAAAGAAGCATTTACTCGAGTAAATGCTTCTTTGACCAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-3371s1c1
Sequence:CCGGGCTTAATCAAGGCAGCCATTACTCGAGTAATGGCTGCCTTGATTAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-3455s1c1
Sequence:CCGGGCATGTCATAGCCAATCTAACCTCGAGGTTAGATTGGCTATGACATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000293.1-2928s1c1
Sequence:CCGGCCTGTCAGATATGACCATGTACTCGAGTACATGGTCATATCTGACAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000293.1-1079s1c1
Sequence:CCGGCAGCTGAAATTAAGCTATTTGCTCGAGCAAATAGCTTAATTTCAGCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-3382s1c1
Sequence:CCGGGCAGCCATTAATATACGAACTCTCGAGAGTTCGTATATTAATGGCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195235    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-3514s1c1
Sequence:CCGGCTCATGATTATGCCAACTATACTCGAGTATAGTTGGCATAATCATGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-3585s1c1
Sequence:CCGGCGCTGCATGTTGTATGATCAACTCGAGTTGATCATACAACATGCAGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-2281s1c1
Sequence:CCGGCCCAACTTCATCACAAAGGAACTCGAGTTCCTTTGTGATGAAGTTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-101s1c1
Sequence:CCGGGCTCAGTTTATGAACCTCTTACTCGAGTAAGAGGTTCATAAACTGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000293.1-875s1c1
Sequence:CCGGCCAGAGAATCAAGATCACATACTCGAGTATGTGATCTTGATTCTCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)