EMAIL THIS PAGE TO A FRIEND

PHKG1

phosphorylase kinase, gamma 1 (muscle)

62 Gene Product Result for
Synonyms: PHKG
UniProtKB ID: Q16816, B7Z1D0, F5H2S1, Q75LP5
Gene ID:
Human(5260) Summary: This gene is a member of the Ser/Thr protein kinase family and encodes a protein with one protein kinase domain and two calmodulin-binding domains. This protein is the catalytic member of a 16 subunit protein kinase complex which contains equimolar ratios of 4 subunit types. The complex is a crucial glycogenolytic regulatory enzyme. This gene has two pseudogenes at chromosome 7q11.21 and one at chromosome 11p11.12. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Mouse(18682) phosphorylase kinase gamma 1
Rat(29353) phosphorylase kinase, gamma 1
chicken(417543) phosphorylase kinase, gamma 1 (muscle)
Horse(100061404) phosphorylase kinase, gamma 1 (muscle)
domestic cat(101081184) phosphorylase kinase, gamma 1 (muscle)
dog(489784) phosphorylase kinase, gamma 1 (muscle)
domestic guinea pig(100732648) phosphorylase kinase, gamma 1 (muscle)
naked mole-rat(101707775) phosphorylase kinase, gamma 1 (muscle)
Domestic Rabbit(100009297) phosphorylase kinase, gamma 1 (muscle)
cow(540682) phosphorylase kinase, gamma 1 (muscle)
sheep(101109323) phosphorylase kinase, gamma 1 (muscle)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006213 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011079 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011079 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011079 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006213 Rosetta Predictions human pricing
NM_031573 Rosetta Predictions rat pricing
NM_011079 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102730 predicted 405
2 SASI_Hs01_00102731 predicted 468
3 SASI_Hs01_00102733 predicted 909
4 SASI_Hs01_00102734 predicted 494
5 SASI_Hs01_00102736 predicted 461
6 SASI_Hs01_00102737 predicted 234
7 SASI_Hs01_00102738 predicted 1114
8 SASI_Hs01_00102739 predicted 1182
9 SASI_Hs02_00341122 predicted 1058
10 SASI_Hs01_00102732 predicted 718
11 SASI_Hs01_00102735 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031573 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078954 predicted 792
2 SASI_Rn02_00264826 predicted 481
3 SASI_Rn01_00078955 predicted 298
4 SASI_Rn01_00078956 predicted 200
5 SASI_Rn01_00078957 predicted 601
6 SASI_Rn01_00078958 predicted 406
7 SASI_Rn01_00078959 predicted 279
8 SASI_Rn01_00078961 predicted 616
9 SASI_Rn01_00078962 predicted 1121
10 SASI_Rn01_00078963 predicted 344
11 SASI_Rn01_00078960 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011079 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181188 predicted 540
2 SASI_Mm01_00181189 predicted 455
3 SASI_Mm01_00181190 predicted 464
4 SASI_Mm01_00181191 predicted 1121
5 SASI_Mm01_00181192 predicted 219
6 SASI_Mm01_00181193 predicted 476
7 SASI_Mm01_00181194 predicted 1217
8 SASI_Mm01_00181196 predicted 587
9 SASI_Mm02_00319851 predicted 1242
10 SASI_Mm02_00319852 predicted 921
11 SASI_Mm01_00181187 predicted 519
12 SASI_Mm01_00181195 predicted 363
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006213
VALIDATED
PHKG1 MISSION shRNA Bacterial Glycerol Stock
phosphorylase kinase, gamma 1 (muscle)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006213.3-236s21c1
Sequence:GTACCGGAGGACTTCTATGAGAATTATGCTCGAGCATAATTCTCATAGAAGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006213.3-457s21c1
Sequence:GTACCGGATACAGCTGAAGGACACTTATCTCGAGATAAGTGTCCTTCAGCTGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006213.3-1142s1c1
Sequence:CCGGTGCGGATCTACTACCAGTACCCTCGAGGGTACTGGTAGTAGATCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006213.3-605s1c1
Sequence:CCGGTGATCTGCACCTTGCACAAACCTCGAGGTTTGTGCAAGGTGCAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006213.3-472s1c1
Sequence:CCGGACTTATGAGACCAACACTTTCCTCGAGGAAAGTGTTGGTCTCATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006213.3-779s21c1
Sequence:GTACCGGTTATCGAGTGCTCCATGAATGCTCGAGCATTCATGGAGCACTCGATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006213.3-334s1c1
Sequence:CCGGGCCGTGAAGGTCATCGACGTCCTCGAGGACGTCGATGACCTTCACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006213.3-772s1c1
Sequence:CCGGCCTGAGATTATCGAGTGCTCCCTCGAGGGAGCACTCGATAATCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006213.3-915s1c1
Sequence:CCGGGATGATCATGAGCGGCAACTACTCGAGTAGTTGCCGCTCATGATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006213.2-1582s1c1
Sequence:CCGGGCCACCATCTCCATTTCTCTTCTCGAGAAGAGAAATGGAGATGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006213.2-841s1c1
Sequence:CCGGGCTGATGCTGAGGATGATCATCTCGAGATGATCATCCTCAGCATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006213.2-1178s1c1
Sequence:CCGGGCCTACGCTTTCCGAATCTATCTCGAGATAGATTCGGAAAGCGTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006213.2-170s1c1
Sequence:CCGGGCACAGGACTTCTATGAGAATCTCGAGATTCTCATAGAAGTCCTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006213
VALIDATED
PHKG1 MISSION shRNA shRNA Plasmid DNA
phosphorylase kinase, gamma 1 (muscle)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006213.3-236s21c1
Sequence:GTACCGGAGGACTTCTATGAGAATTATGCTCGAGCATAATTCTCATAGAAGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006213.3-457s21c1
Sequence:GTACCGGATACAGCTGAAGGACACTTATCTCGAGATAAGTGTCCTTCAGCTGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006213.3-1142s1c1
Sequence:CCGGTGCGGATCTACTACCAGTACCCTCGAGGGTACTGGTAGTAGATCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006213.3-605s1c1
Sequence:CCGGTGATCTGCACCTTGCACAAACCTCGAGGTTTGTGCAAGGTGCAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006213.3-472s1c1
Sequence:CCGGACTTATGAGACCAACACTTTCCTCGAGGAAAGTGTTGGTCTCATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006213.3-779s21c1
Sequence:GTACCGGTTATCGAGTGCTCCATGAATGCTCGAGCATTCATGGAGCACTCGATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006213.3-334s1c1
Sequence:CCGGGCCGTGAAGGTCATCGACGTCCTCGAGGACGTCGATGACCTTCACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006213.3-772s1c1
Sequence:CCGGCCTGAGATTATCGAGTGCTCCCTCGAGGGAGCACTCGATAATCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006213.3-915s1c1
Sequence:CCGGGATGATCATGAGCGGCAACTACTCGAGTAGTTGCCGCTCATGATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006213.2-1582s1c1
Sequence:CCGGGCCACCATCTCCATTTCTCTTCTCGAGAAGAGAAATGGAGATGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006213.2-841s1c1
Sequence:CCGGGCTGATGCTGAGGATGATCATCTCGAGATGATCATCCTCAGCATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006213.2-1178s1c1
Sequence:CCGGGCCTACGCTTTCCGAATCTATCTCGAGATAGATTCGGAAAGCGTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006213.2-170s1c1
Sequence:CCGGGCACAGGACTTCTATGAGAATCTCGAGATTCTCATAGAAGTCCTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006213
VALIDATED
PHKG1 MISSION shRNA Lentiviral Transduction Particles
phosphorylase kinase, gamma 1 (muscle)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006213.3-236s21c1
Sequence:GTACCGGAGGACTTCTATGAGAATTATGCTCGAGCATAATTCTCATAGAAGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006213.3-457s21c1
Sequence:GTACCGGATACAGCTGAAGGACACTTATCTCGAGATAAGTGTCCTTCAGCTGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006213.3-1142s1c1
Sequence:CCGGTGCGGATCTACTACCAGTACCCTCGAGGGTACTGGTAGTAGATCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006213.3-605s1c1
Sequence:CCGGTGATCTGCACCTTGCACAAACCTCGAGGTTTGTGCAAGGTGCAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006213.3-472s1c1
Sequence:CCGGACTTATGAGACCAACACTTTCCTCGAGGAAAGTGTTGGTCTCATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006213.3-779s21c1
Sequence:GTACCGGTTATCGAGTGCTCCATGAATGCTCGAGCATTCATGGAGCACTCGATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006213.3-334s1c1
Sequence:CCGGGCCGTGAAGGTCATCGACGTCCTCGAGGACGTCGATGACCTTCACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006213.3-772s1c1
Sequence:CCGGCCTGAGATTATCGAGTGCTCCCTCGAGGGAGCACTCGATAATCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006213.3-915s1c1
Sequence:CCGGGATGATCATGAGCGGCAACTACTCGAGTAGTTGCCGCTCATGATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006213.2-1582s1c1
Sequence:CCGGGCCACCATCTCCATTTCTCTTCTCGAGAAGAGAAATGGAGATGGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006213.2-841s1c1
Sequence:CCGGGCTGATGCTGAGGATGATCATCTCGAGATGATCATCCTCAGCATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006213.2-1178s1c1
Sequence:CCGGGCCTACGCTTTCCGAATCTATCTCGAGATAGATTCGGAAAGCGTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006213.2-170s1c1
Sequence:CCGGGCACAGGACTTCTATGAGAATCTCGAGATTCTCATAGAAGTCCTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011079
PHKG1 MISSION shRNA Bacterial Glycerol Stock
phosphorylase kinase, gamma 1 (muscle)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011079.2-1662s21c1
Sequence:CCGGTCAACCTCTGGTACAGCTAAACTCGAGTTTAGCTGTACCAGAGGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011079.2-907s21c1
Sequence:CCGGGATGATCATGGACGGCAAATACTCGAGTATTTGCCGTCCATGATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011079.1-889s1c1
Sequence:CCGGCCGGAAGCAAATGCTGATGTTCTCGAGAACATCAGCATTTGCTTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011079.1-310s1c1
Sequence:CCGGCAAACCCACATGCCAGGAATACTCGAGTATTCCTGGCATGTGGGTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011079.1-496s1c1
Sequence:CCGGCTTGGTATTTGATCTGATGAACTCGAGTTCATCAGATCAAATACCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011079.1-1049s1c1
Sequence:CCGGCCTTTCTTTCAGGAGTACGTACTCGAGTACGTACTCCTGAAAGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011079.1-1129s1c1
Sequence:CCGGGCTGGCATCAGTAAAGATCTACTCGAGTAGATCTTTACTGATGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011079
PHKG1 MISSION shRNA shRNA Plasmid DNA
phosphorylase kinase, gamma 1 (muscle)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011079.2-1662s21c1
Sequence:CCGGTCAACCTCTGGTACAGCTAAACTCGAGTTTAGCTGTACCAGAGGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011079.2-907s21c1
Sequence:CCGGGATGATCATGGACGGCAAATACTCGAGTATTTGCCGTCCATGATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011079.1-889s1c1
Sequence:CCGGCCGGAAGCAAATGCTGATGTTCTCGAGAACATCAGCATTTGCTTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011079.1-310s1c1
Sequence:CCGGCAAACCCACATGCCAGGAATACTCGAGTATTCCTGGCATGTGGGTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011079.1-496s1c1
Sequence:CCGGCTTGGTATTTGATCTGATGAACTCGAGTTCATCAGATCAAATACCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011079.1-1049s1c1
Sequence:CCGGCCTTTCTTTCAGGAGTACGTACTCGAGTACGTACTCCTGAAAGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011079.1-1129s1c1
Sequence:CCGGGCTGGCATCAGTAAAGATCTACTCGAGTAGATCTTTACTGATGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011079
PHKG1 MISSION shRNA Lentiviral Transduction Particles
phosphorylase kinase, gamma 1 (muscle)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011079.2-1662s21c1
Sequence:CCGGTCAACCTCTGGTACAGCTAAACTCGAGTTTAGCTGTACCAGAGGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011079.2-907s21c1
Sequence:CCGGGATGATCATGGACGGCAAATACTCGAGTATTTGCCGTCCATGATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011079.1-889s1c1
Sequence:CCGGCCGGAAGCAAATGCTGATGTTCTCGAGAACATCAGCATTTGCTTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011079.1-310s1c1
Sequence:CCGGCAAACCCACATGCCAGGAATACTCGAGTATTCCTGGCATGTGGGTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011079.1-496s1c1
Sequence:CCGGCTTGGTATTTGATCTGATGAACTCGAGTTCATCAGATCAAATACCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011079.1-1049s1c1
Sequence:CCGGCCTTTCTTTCAGGAGTACGTACTCGAGTACGTACTCCTGAAAGAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011079.1-1129s1c1
Sequence:CCGGGCTGGCATCAGTAAAGATCTACTCGAGTAGATCTTTACTGATGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)